Proteintech, G65086-1-5C, MultiPro® 5CFLX Anti-Human CD11c (3.9)

Size: 10ug The CD11c (G65086-1-5C) by Proteintech is a Monoclonal antibody targeting CD11c in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65086-1-5C targets CD11c in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information Integrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11c, also known as integrin αX, is a type I transmembrane glycoprotein present on a variety of cells, including monocytes/macrophages, granulocytes, a subset of B cells, NK cells and dendritic cells (PMID: 2897326; 1680915; 1694698; 17389580). As a result of its high level of expression on most dendritic cells, CD11c is typically considered to be a marker of conventional dendritic cells (PMID: 27119555). CD11c forms an α/β heterodimer with CD18 (integrin β2). CD11c/CD18 acts a receptor for fibrinogen and is important in monocyte adhesion and chemotaxis (PMID: 1671533). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Rheumatoid synovial cells and human monocytes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD11c (3.9) Calculated Molecular Weight: 1169 aa, 129 kDa GenBank Accession Number: BC038237 Gene Symbol: CD11c Gene ID (NCBI): 3687 ENSEMBL Gene ID: ENSG00000140678 RRID: AB_3673910 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAAGCAATACTTATACCCCATATAAGAAA Barcode Sequence: AAGCAATACTTATAC Form: Liquid UNIPROT ID: P20702 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.