Proteintech, G65099-1-5C, MultiPro® 5CFLX Anti-Human CD28 (CD28.2)

Size: 10ug The CD28 (G65099-1-5C) by Proteintech is a Monoclonal antibody targeting CD28 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65099-1-5C targets CD28 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD28 (T-cell-specific surface glycoprotein CD28), also known as T44 and Tp44, is a 44 kD disulfide-linked homodimeric type I glycoprotein (PMID: 2162180). It is a member of the immunoglobulin superfamily and is expressed on most T lineage cells, NK cell subsets, and plasma cells (PMID: 2162180, 8386518). CD28 may affect in vivo immune responses by functioning both as a cell adhesion molecule linking B and T lymphocytes and as the surface component of a novel signal transduction pathway (PMID: 2162180, 3021470). CD28 binds both CD80 and CD86 with a highly conserved motif MYPPY in the CDR3-like loop (PMID: 15696168, 7964482). CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death (PMID: 1348520). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD28 (CD28.2) Calculated Molecular Weight: 220 aa, 25 kDa GenBank Accession Number: BC093698 Gene Symbol: CD28 Gene ID (NCBI): 940 ENSEMBL Gene ID: ENSG00000178562 RRID: AB_3673912 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTTATCGCAACGTTACCCATATAAGAAA Barcode Sequence: GTTATCGCAACGTTA Form: Liquid UNIPROT ID: P10747 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.