Proteintech, G65103-1-5C, MultiPro® 5CFLX Anti-Human CD40 (G28.5)

Size: 10ug The CD40 (G65103-1-5C) by Proteintech is a Monoclonal antibody targeting CD40 in Single Cell (Intra) applications with reactivity to Human samples G65103-1-5C targets CD40 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information CD40, also named as TNFRSF5 and Bp50, is a type I transmembrane protein that belongs to the tumor necrosis factor-R (TNF-R) family (PMID: 10647992). CD40 is expressed on B cells, dendritic cells (DCs), monocytes, platelets, and macrophages as well as by non-hematopoietic cells such as myofibroblasts, fibroblasts, epithelial, and endothelial cells (PMID: 19426221). It is a receptor for TNFSF5/CD40LG. CD40L/CD40 interactions are essential for immunoglobulin (Ig) isotype switching, germinal center formation and the development of B cell memory (PMID: 7516405; 11675497). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD40 (G28.5) Calculated Molecular Weight: 277 aa, 31 kDa GenBank Accession Number: BC012419 Gene Symbol: CD40 Gene ID (NCBI): 958 ENSEMBL Gene ID: ENSG00000101017 RRID: AB_3673913 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTGCTATGACGTACCCCATATAAGAAA Barcode Sequence: ATTGCTATGACGTAC Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.