Proteintech, G65204-1-5C, MultiPro® 5CFLX Anti-Human CD8 (UCHT4)

Size: 10ug The CD8 (G65204-1-5C) by Proteintech is a Monoclonal antibody targeting CD8 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65204-1-5C targets CD8 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD8 is a transmembrane glycoprotein composed of two disulfide-linked chains. It can be present as a homodimer of CD8α or as a heterodimer of CD8α and CD8β (PMID: 3264320; 8253791). CD8 is found on most thymocytes. The majority of class I-restricted T cells express mostly the CD8αβ heterodimer while CD8αα homodimers alone have been found on some gut intraepithelial T cells , on some T cell receptor (TCR) γδ T cells and on NK cells (PMID: 2111591; 1831127; 8420975). CD8 acts as a co-receptor that binds to MHC class-I and participates in cytotoxic T cell activation (PMID: 8499079). During T cell development, CD8 is required for positive selection of CD4-/CD8+ T cells (PMID: 1968084). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: Thymocytes and Sézary T cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD8 (UCHT4) Calculated Molecular Weight: 235 aa, 26 kDa GenBank Accession Number: BC025715 Gene Symbol: CD8A Gene ID (NCBI): 925 ENSEMBL Gene ID: ENSG00000153563 RRID: AB_3673935 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGGAATCTAATACCACCCATATAAGAAA Barcode Sequence: TGGAATCTAATACCA Form: Liquid UNIPROT ID: P01732 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.