Iright
BRAND / VENDOR: Proteintech

Proteintech, G65254-1-5C, MultiPro® 5CFLX Anti-Human CD35 (E11)

CATALOG NUMBER: G65254-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The CD35 (G65254-1-5C) by Proteintech is a Monoclonal antibody targeting CD35 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65254-1-5C targets CD35 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD35, also known as complement receptor type 1 (CR1) or C3b/C4b receptor, is a single-chain glycoprotein consisting of 30 repeating homologous protein domains known as short consensus repeats (~60 amino acids each) followed by transmembrane and cytoplasmic domains (PMID: 8765013). CD35 is variably expressed by granulocytes, monocytes, B cells, some T cells, erythrocytes, follicular dendritic cells, Langerhans cells, and glomerular podocytes (PMID: 19004497). CD35 acts as a receptor for C3b and C4b and plays important roles in the regulation of the complement cascade and clearance of immune complexes. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human CD35 from Acute monocytic leukemia cells and normal blood monocytes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD35 (E11) Calculated Molecular Weight: 224 kDa GenBank Accession Number: NM_000573 Gene Symbol: CR1 Gene ID (NCBI): 1378 ENSEMBL Gene ID: ENSG00000203710 RRID: AB_3673940 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAATGAATTGGATTCGCCCATATAAGAAA Barcode Sequence: AATGAATTGGATTCG Form: Liquid UNIPROT ID: P17927 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924