Iright
BRAND / VENDOR: Proteintech

Proteintech, G66035-1-5C, MultiPro® 5CFLX Anti-Human Annexin A2 (1C1E12)

CATALOG NUMBER: G66035-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The Annexin A2 (G66035-1-5C) by Proteintech is a Monoclonal antibody targeting Annexin A2 in Single Cell (Intra) applications with reactivity to Human samples G66035-1-5C targets Annexin A2 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Annexin A2 (ANXA2), also named Annexin-2 or Lipocortin II, is a Ca2+ binding protein that is up-regulated in virally transformed cell lines and human tumors. This calcium-regulated membrane-binding protein, whose affinity for calcium is greatly enhanced by anionic phospholipids, may cross-link plasma membrane phospholipids with actin and the cytoskeleton and be involved with exocytosis. Heat-stress response may also involve Annexin-2. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag16654 Product name: Recombinant human Annexin A2 protein Source: e coli. -derived, PET28a Tag: 6*His Domain: 1-339 aa of BC016774 Sequence: MSTVHEILCKLSLEGDHSTPPSAYGSVKAYTNFDAERDALNIETAIKTKGVDEVTIVNILTNRSNAQRQDIAFAYQRRTKKELASALKSALSGHLETVILGLLKTPAQYDASELKASMKGLGTDEDSLIEIICSRTNQELQEINRVYKEMYKTDLEKDIISDTSGDFRKLMVALAKGRRAEDGSVIDYELIDQDARDLYDAGVKRKGTDVPKWISIMTERSVPHLQKVFDRYKSYSPYDMLESIRKEVKGDLENAFLNLVQCIQNKPLYFADRLYDSMKGKGTRDKVLIRIMVSRSEVDMLKIRSEFKRKYGKSLYYYIQQDTKGDYQKALLYLCGGDD Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human Annexin A2 (1C1E12) Calculated Molecular Weight: 339 aa, 39 kDa GenBank Accession Number: BC016774 Gene Symbol: Annexin A2 Gene ID (NCBI): 302 ENSEMBL Gene ID: ENSG00000182718 RRID: AB_3673941 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGGTCAACTGAGTCCGCCCATATAAGAAA Barcode Sequence: GGTCAACTGAGTCCG Form: Liquid UNIPROT ID: P07355 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924