Iright
BRAND / VENDOR: Proteintech

Proteintech, G66180-1-5C, MultiPro® 5CFLX Anti-Human CD71 (3C11F11)

CATALOG NUMBER: G66180-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The CD71 (G66180-1-5C) by Proteintech is a Monoclonal antibody targeting CD71 in Single Cell (Intra) applications with reactivity to Human samples G66180-1-5C targets CD71 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information CD71, also known as transferrin receptor protein 1 (TfR1), is a transmembrane glycoprotein composed of two disulfide-linked monomers, each of 90 kDa molecular weight. Each monomer binds one holo-transferrin molecule creating an iron-Tf-TfR complex which enters the cell by endocytosis. CD71 is present on actively proliferating cells and is essential for iron transport into proliferating cells. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag21612 Product name: Recombinant human CD71 protein Source: e coli. -derived, PET30a Tag: 6*His Domain: 513-757 aa of BC001188 Sequence: VKHPVTGQFLYQDSNWASKVEKLTLDNAAFPFLAYSGIPAVSFCFCEDTDYPYLGTTMDTYKELIERIPELNKVARAAAEVAGQFVIKLTHDVELNLDYERYNSQLLSFVRDLNQYRADIKEMGLSLQWLYSARGDFFRATSRLTTDFGNAEKTDRFVMKKLNDRVMRVEYHFLSPYVSPKESPFRHVFWGSGSHTLPALLENLKLRKQNNGAFNETLFRNQLALATWTIQGAANALSGDVWDID Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD71 (3C11F11) Calculated Molecular Weight: 85 kDa GenBank Accession Number: BC001188 Gene Symbol: CD71 Gene ID (NCBI): 7037 ENSEMBL Gene ID: ENSG00000072274 RRID: AB_3673944 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAACCACACTTACGTTCCCATATAAGAAA Barcode Sequence: AACCACACTTACGTT Form: Liquid UNIPROT ID: P02786 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924