Iright
BRAND / VENDOR: Proteintech

Proteintech, G66308-1-5C, MultiPro® 5CFLX Anti-Human CD27 (1C1G3)

CATALOG NUMBER: G66308-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The CD27 (G66308-1-5C) by Proteintech is a Monoclonal antibody targeting CD27 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G66308-1-5C targets CD27 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD27 (also known as TNFRSF7) is a type I glycoprotein expressed on some B cells and the majority of T cells, and is a member of the tumor necrosis factor (TNF) receptor family. CD27 is required for generation and long-term maintenance of T cell immunity (PMID: 11062504). It is a receptor for CD70 (CD27L). Ligation of CD27 by CD70 induces strong ubiquitination of TRAF and the activation of both canonical and non-canonical NF-kappaB pathways, as well as the JNK pathway (PMID: 19426224). CD27 may also play a role in apoptosis through association with SIVA1. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag24537 Product name: Recombinant human CD27 protein Source: e coli. -derived, PET30a Tag: 6*His Domain: 1-260 aa of BC012160 Sequence: MARPHPWWLCVLGTLVGLSATPAPKSCPERHYWAQGKLCCQMCEPGTFLVKDCDQHRKAAQCDPCIPGVSFSPDHHTRPHCESCRHCNSGLLVRNCTITANAECACRNGWQCRDKECTECDPLPNPSLTARSSQALSPHPQPTHLPYVSEMLEARTAGHMQTLADFRQLPARTLSTHWPPQRSLCSSDFIRILVIFSGMFLVFTLAGALFLHQRRKYRSNKGESPVEPAEPCRYSCPREEEGSTIPIQEDYRKPEPACSP Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD27 (1C1G3) Calculated Molecular Weight: 29 kDa GenBank Accession Number: BC012160 Gene Symbol: CD27 Gene ID (NCBI): 939 ENSEMBL Gene ID: ENSG00000139193 RRID: AB_3673946 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGTGAGCGCAATCAGCCCATATAAGAAA Barcode Sequence: TGTGAGCGCAATCAG Form: Liquid UNIPROT ID: P26842 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924