Proteintech, G66360-2-5C, MultiPro® 5CFLX Mouse IgG2a Isotype Control (11A1B2)

Size: 10ug The Mouse IgG2a isotype control (G66360-2-5C) by Proteintech is a Monoclonal antibody targeting Mouse IgG2a isotype control in Single Cell (Intra) applications with reactivity to NA samples G66360-2-5C targets Mouse IgG2a isotype control in Single Cell (Intra) applications and shows reactivity with NA samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information This antibody is used as the isotype control of mouse IgG2a. It can be used as the isotype control in Flow Cytometry, Immuno-Precipitation and other experiments. The immunogen of this antibody is Keyhole Limpet Hemocyanin (KLH). Specification Tested Reactivity: NA Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: Recombinant protein Predict reactive species Full Name: MultiPro® 5CFLX Mouse IgG2a Isotype Control (11A1B2) RRID: AB_3673950 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAGATACTCGTGTTACCCCATATAAGAAA Barcode Sequence: AGATACTCGTGTTAC Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.