Iright
BRAND / VENDOR: Proteintech

Proteintech, G66762-1-5C, MultiPro® 5CFLX Anti-Human BACH1 (2D12A4)

CATALOG NUMBER: G66762-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The BACH1 (G66762-1-5C) by Proteintech is a Monoclonal antibody targeting BACH1 in Single Cell (Intra) applications with reactivity to Human samples G66762-1-5C targets BACH1 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information BTB and CNC homology 1, basic leucine zipper transcription factor 1(BACH1) is a heme-regulated transcriptional regulator that acts as a repressor or activator and a member of the AP-a superfamily. MafK belongs to the small Maf family that can function as transcriptional activators or repressors depending on the proteins with which they form heterodimers. BACH1 has crucial roles in both stress responses and transformation by H-RasV12. The molecular weight of expected mobility Bach1 is 100-110 kDa. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag6011 Product name: Recombinant human BACH1 protein Source: e coli. -derived, PET28a Tag: 6*His Domain: 387-736 aa of BC063307 Sequence: SSVEREVAEHLAKGFWSDICSTDTPCQMQLSPAVAKDGSEQISQKRSECPWLGIRISESPEPGQRTFTTLSSVNCPFISTLSTEGCSSNLEIGNDDYVSEPQQEPCPYACVISLGDDSETDTEGDSESCSAREQECEVKLPFNAQRIISLSRNDFQSLLKMHKLTPEQLDCIHDIRRRSKNRIAAQRCRKRKLDCIQNLESEIEKLQSEKESLLKERDHILSTLGETKQNLTGLCQKVCKEAALSQEQIQILAKYSAADCPLSFLISEKDKSTPDGELALPSIFSLSDRPPAVLPPCARGNSEPGYARGQESQQMSTATSEQAGPAEQCRQSGGISDFCQQMTDKCTTDE Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human BACH1 (2D12A4) Calculated Molecular Weight: 82 kDa GenBank Accession Number: BC063307 Gene Symbol: BACH1 Gene ID (NCBI): 571 ENSEMBL Gene ID: ENSG00000156273 RRID: AB_3673961 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGCCATCACGGCACGTCCCATATAAGAAA Barcode Sequence: GCCATCACGGCACGT Form: Liquid UNIPROT ID: O14867 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924