Proteintech, G80084-1-5C, MultiPro® 5CFLX Anti-Human Phospho-Beta Catenin (Ser675) (6D6)

Size: 10ug The Phospho-Beta Catenin (Ser675) (G80084-1-5C) by Proteintech is a Recombinant antibody targeting Phospho-Beta Catenin (Ser675) in Single Cell (Intra) applications with reactivity to Human samples G80084-1-5C targets Phospho-Beta Catenin (Ser675) in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information β-Catenin, also known as CTNNB1, is an evolutionarily conserved, multifunctional intracellular protein. β-Catenin was originally identified in cell adherens junctions (AJs) where it functions to bridge the cytoplasmic domain of cadherins to a-catenin and the actin cytoskeleton. Besides its essential role in the AJs, β-catenin is also a key downstream component of the canonical Wnt pathway that plays diverse and critical roles in embryonic development and adult tissue homeostasis. The Wnt/β-catenin pathway is also involved in the activation of other intracellular messengers such as calcium fluxes, JNK, and SRC kinases. Deregulation of β-catenin activity is associated with multiple diseases including cancers. (PMID: 22617422; 18334222). PKA was shown to phosphorylate β-catenin at Ser675. Phosphorylation at Ser675 induces β-catenin accumulation in the nucleus and increases its transcriptional activity. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Recombinant Immunogen: Peptide Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human Phospho-Beta Catenin (Ser675) (6D6) Calculated Molecular Weight: 781 aa, 86 kDa GenBank Accession Number: BC058926 Gene Symbol: Beta Catenin Gene ID (NCBI): 1499 ENSEMBL Gene ID: ENSG00000168036 RRID: AB_3673975 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGATATCTTAATCCGAACCCATATAAGAAA Barcode Sequence: ATATCTTAATCCGAA Form: Liquid UNIPROT ID: P35222 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.