BRAND / VENDOR: Thermo Fisher

Thermo Fisher, SO120, T3 promoter Sequencing Primer, 24-mer

CATALOG NUMBER: SO120

Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • quedan 99 artículos
  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

Thermo Fisher, SO120, T3 promoter Sequencing Primer, 24-mer Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such aspTZ19R, pTZ57R, and pBluescript IIPromoter Sequence5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'Related productsSP6 promoter Sequencing Primer, 18-merT3 promoter Sequencing Primer, 17-merSP6 promoter Sequencing Primer, 24-merT7 promoter Sequencing Primer, 20-merNotes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylatedFor Use With (Application): Sequencing
Form: Liquid
Product Type: Sequencing Primer
Quantity: 10 μM, 42 μL
Shipping Condition: Dry Ice
Concentration: 10 μM
Primer: T3
Promoter: SP6, T3, T7
Unit Size: 10 µM

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924