BD, 940091, BD™ AbSeq Oligo Mouse Anti-Human CD275

Alternative Name: ICOSLG; ICOS ligand; LICOS; B7-H2; B7 homolog 2; B7RP-1; GL50
Entrez Gene ID: 23308
Vol. Per Test: 2 µl
Isotype: Mouse IgG2b, κ
Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Barcode Sequence: GTTTATATGTACGACGCCCGGTTGACGAGTGGAAGT
Sequence ID: AHS0011
Immunogen: Human B7-H2
Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory Status: RUO
Host Species: Mouse
Preparation And Storage: Preparation And Storage Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures: Recommended Assay Procedures Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.