Iright
BRAND / VENDOR: Biolegend

Biolegend, 302973, TotalSeq™-D0386 anti-human CD28 Antibody, 10μg

CATALOG NUMBER: 302973
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD28 is a 44 kD disulfide-linked homodimeric type I glycoprotein. It is a member of the immunoglobulin superfamily and is also known as T44 or Tp44. CD28 is expressed on most T lineage cells, NK cell subsets, and plasma cells. CD28 binds both CD80 and CD86 using a highly conserved motif MYPPY in the CDR3-like loop. CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death. In vitro studies indicate that ligation of CD28 on T cells by CD80 and CD86 on antigen presenting cells provides a costimulatory signal required for T cell activation and proliferation.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: Baboon, Capuchin Monkey, Chimpanzee, Pigtailed Macaque, Sooty Mangabey, Squirrel Monkey
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. Nunes J, et al. 1993. Biochem. J. 293:835. Calea-Lauri J, et al. 1999. J. Immunol. 163:62. Tazi A, et al. 1999. J. Immunol. 163:3511. (IHC) Marti F, et al. 2001. J. Immunol. 166:197. (Costim) Jeong SH, et al. 2004. J. Virol. 78:6995. (Costim) Rivollier A, et al. 2004. Blood 104:4029. (Costim) Scharschmidt E, et al. 2004. Mol. Cell Biol. 24:3860. (Costim) Sheng W, et al. 2007.Elsevier 580:6819. PubMed Mitsuhashi M. 2007. Clin Chem.53:148. PubMed Ye Z, et al. 2008. Infect. Immun. 76:2541. PubMed Magatti M, et al. 2008. Stem Cells 26:182. (FA) PubMed Yoshino N, et al. 2008. Exp. Anim. (Tokyo) 49:97. (FC) Berg M, et al. 2008. J Leukoc Biol. 83:853. (IP) PubMed Rout N, et al. 2010. PLoS One 5:e9787. (FC) Leonard JA, et al. 2011. J. Virol. 85:6867. PubMed Nomura T, et al. 2012. J. Virol. 86:6481. PubMed
RRID: AB_2910379 (BioLegend Cat. No. 302973)
Structure: Ig superfamily, type I transmembrane glycoprotein, homodimer, 44 kD
Distribution: Mature T cells, thymocytes, NK cell subsets, plasma cells, EBV-positive B cells
Function: T cell costimulation
Ligand/Receptor: CD80, CD86
Cell Type: B cells, NK cells, Plasma cells, T cells, Thymocytes, Tregs
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. 2. June CH, et al. 1994. Immunol. Today 15:321. 3. Linskey PS, et al. 1993. Annu. Rev. Immunol. 11:191.
Gene ID: 940
UniProt: View information about CD28 on UniProt.org
Clone: CD28.2
Regulatory Status: RUO
Workshop: V-CD28.05
Other Names: T44, Tp44
Isotype: Mouse IgG1, κ
Barcode Sequence: TGAGAACGACCCTAA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924