Product Description
CD95 is a 45 kD single chain type I glycoprotein also known as Fas, APO-1, and TNFRSF6. It is a member of the TNF receptor superfamily. CD95 is expressed on T and B lymphocytes, monocytes, neutrophils, and fibroblasts. CD95 expression is upregulated by activation. The extracellular region of CD95 binds to CD178 (Fas ligand). CD178 binding to CD95 induces apoptosis and has been shown to play a role in the maintenance of peripheral tolerance.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Pigtailed Macaque, Sooty Mangabey
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: CD95 transfected L cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The DX2 antibody is useful for inducing apoptosis of Fas-positive cells. Additional reported applications (for the relevant formats) include: in vitro induction of apoptosis3 (DX2 antibody is required to be cross-linked for effective induction of apoptosis) and immunohistochemical staining4,5 of acetone-fixed frozen tissue sections and formalin-fixed paraffin-embedded tissue sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 305655 and 305656). Note: EOS9.1 antibody can induce apoptosis without cross-linking.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds.1995. Leucocyte Typing V. Oxford University Press. New York. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. New York. Cifone M, et al. 1994. J. Exp. Med. 180:1547. (Apop) Zietz C, et al. 2001. Am. J. Pathol. 159:963. (IHC) Sergi C, et al. 2000. Am. J. Pathol. 156:1589. (IHC) Xie S, et al. 2010. J. Immunol. 184:2289. (FC) PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21. Rout N, et al. 2010. PLoS One 5:e9787. (FC) Dixit N, et al. 2012. J. Immunol. 189:5954. PubMed
RRID: AB_2892366 (BioLegend Cat. No. 305659)
Structure: TNFR superfamily, type I transmembrane protein, 45 kD
Distribution: T cells and B cells, monocytes, neutrophils, fibroblasts, expression level upregulated on activated lymphocytes
Function: Mediates apoptosis
Ligand/Receptor: Fas ligand (CD178)
Cell Type: B cells, Fibroblasts, Lymphocytes, Monocytes, Neutrophils, T cells
Biology Area: Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Neuroscience
Molecular Family: CD Molecules
Antigen References: 1. Krammer P, et al. 1994. Immunol. Rev. 142:175. 2. Nagata S, et al. 1995. Science 267:1449.
Gene ID: 355
UniProt: View information about CD95 on UniProt.org
Clone: DX2
Regulatory Status: RUO
Workshop: VI C-64
Other Names: Fas, APO-1, TNFRSF6
Isotype: Mouse IgG1, κ
Barcode Sequence: CCAGCTCATTAGAGC
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924