Biolegend, 306051, TotalSeq™-D0064 anti-human CD123 Antibody, 10μg

CD123 is the 70 kD transmembrane α chain of the IL-3 receptor. Alone, CD123 binds IL-3 with low affinity; when CD123 associates with CD131 (common β chain), it binds IL-3 with high affinity. CD123 does not transduce intracellular signals upon binding IL-3 and requires the β chain for this function. CD123 is expressed by myeloid precursors, macrophages, dendritic cells, mast cells, basophils, megakaryocytes, and some B cells.
10μg
Verified Reactivity: Human
Reported Reactivity: Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human IL-3Rα transfected COS cells.
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone 6H6 does not inhibit IL-3 binding to low- or high-affinity IL-3Rs. Additional reported applications (for the relevant formats) include: Western blotting1, immunoprecipitation1, and immunohistochemical staining of acetone-fixed frozen sections2 and also paraformaldehyde fixed paraffin embedded tissue7.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Sun Q, et al. 1996. Blood 87:83. (IP, WB) Herling M, et al. 2003. Blood 101:5007. (IHC) Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed Martin-Gayo E, et al. 2010. Blood 115:5366. PubMed Chen SC, et al. 2010. Arch Dermatol Res. 302:113. PubMed Liu Y, et al. 2012. Food Chem Toxicol. 50:1920. PubMed Peduzzi E, et al. 2007. J. Invest. Dermatol. 127:638. (IHC)
RRID: AB_2892367 (BioLegend Cat. No. 306051)
Structure: Ig superfamily, type I transmembrane glycoprotein, associates with CDw131, 70 kD
Distribution: Myeloid precursors, basophils, mast cells, macrophages, dendritic cells, megakaryocytes, subset of lymphocytes
Function: Hematopoietic cell proliferation, differentiation
Ligand/Receptor: IL-3
Cell Type: Basophils, Dendritic cells, Hematopoietic stem and progenitors, Lymphocytes, Macrophages, Mast cells, Megakaryocytes
Biology Area: Immunology
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Miyajima A, et al. 1993. Blood 82:1960.
Gene ID: 3563
UniProt: View information about CD123 on UniProt.org
Clone: 6H6
Regulatory Status: RUO
Other Names: IL-3Rα, IL-3 Receptor alpha
Isotype: Mouse IgG1, κ
Barcode Sequence: CTTCACTCTGTCAGG