Iright
BRAND / VENDOR: Biolegend

Biolegend, 306321, TotalSeq™-D0870 anti-human CD150 (SLAM) Antibody, 10μg

CATALOG NUMBER: 306321
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD150 is a 70-95 kD type I transmembrane glycoprotein also known as SLAM or IPO-3. It is a member of the Ig superfamily. It is expressed on a subset of T cells, B cells, dendritic cells, and endothelial cells. The expression of CD150 is upregulated upon activation. CD150 binds to itself as the ligand to be involved in B cell costimulation, proliferation, immunoglobulin production, and signal transduction.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Activated human PBMC
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, immunoprecipitation4, and costimulation1,5 of IFN-gamma production and T cell proliferation. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 306317 and 306318).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Garcia V, et al. 2001. J. Immunol. 167:5719. (Costim) Vincent S, et al. 2002. J. Virol. 76:6121. Cocks B, et al. 1995. Nature 376:260. Sayos J, et al. 2001. Blood 97:3867. (IP) Aversa G, et al. 1997. J. Immunol. 158:4036. (Costim) Spencer M, et al. 2010. Am. J. Physiol Endocrinol Metab. 299:1016. PubMed
RRID: AB_2941475 (BioLegend Cat. No. 306321)
Structure: Ig superfamily, type I transmembrane glycoprotein, 70-95 kD
Distribution: T subset (upregulated after activation), B cells, dendritic cells, endothelial cells
Function: B cell costimulation, proliferation and Ig production
Ligand/Receptor: CD150 (self ligand)
Cell Type: B cells, Dendritic cells, Endothelial cells, T cells, Tregs
Biology Area: Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Cocks B, et al. 1995. Nature 376:260. 2. Pinchouk V, et al. 1988. AntiCancer Res. 8:1377. 3. Polacino P, et al. 1996. J. Med. Primatol. 25:201. 4. Punnonen J, et al. 1997. J. Exp. Med. 185:993.
Gene ID: 6504
UniProt: View information about CD150 on UniProt.org
Clone: A12 (7D4)
Regulatory Status: RUO
Other Names: SLAM, Signaling Lymphocyte Activation Molecule, IPO-3
Isotype: Mouse IgG1, κ
Barcode Sequence: GTCATTGTATGTCTG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924