Iright
BRAND / VENDOR: Biolegend

Biolegend, 309239, TotalSeq™-D0367 anti-human CD2 Antibody, 10μg

CATALOG NUMBER: 309239
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD2 is a 50 kD type I transmembrane glycoprotein also known as LFA-2, T11, and sheep red blood cell receptor (SRBC-R). This immunoglobulin superfamily member is expressed on thymocytes, T lymphocytes, NK cells, and thymic B cell subsets. The major ligand for CD2 is CD58 (also known as LFA-3). CD2 has also been reported to bind CD48, CD59, and CD15. CD2 plays a critical role in alternative T cell activation, T cell signaling, and cell-cell adhesion.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: blocking of T cell activation, and partial blocking of B cell costimulation2. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 309235 & 309236).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds.1995. Leucocyte Typing V Oxford University Press. New York. Hughes CCW, et al. 1996. J. Biol. Chem. 271:5369.
RRID: AB_2894548 (BioLegend Cat. No. 309239)
Structure: Ig superfamily, type I transmembrane glycoprotein, 50 kD
Distribution: T cells, NK cells, thymocytes, and thymic B cell subsets
Function: T cell activation, adhesion
Ligand/Receptor: CD58 (LFA-3), CD48, CD59, CD15
Cell Type: B cells, NK cells, T cells, Thymocytes
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Bell G, et al. 1995. J. Immunol. 155:2805. 2. Bierer B, et al. 1989. Annu. Rev. Immunol. 7:579. 3. Moingeon P, et al. 1989. Immunol. Rev. 111:111.
Gene ID: 914
UniProt: View information about CD2 on UniProt.org
Clone: TS1/8
Regulatory Status: RUO
Workshop: V S025
Other Names: LFA-2, T11, SRBC-R
Isotype: Mouse IgG1, κ
Barcode Sequence: TACGATTTGTCAGGG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924