Iright
BRAND / VENDOR: Biolegend

Biolegend, 318821, TotalSeq™-D0020 anti-human CD270 (HVEM, TR2) Antibody, 10μg

CATALOG NUMBER: 318821
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

The 122 antibody recognizes human HVEM also known as herpesvirus entry mediator A, tumor necrosis factor receptor superfamily, member 14, TNFRSF14, and tumor necrosis factor receptor like 2. HVEM, a member of the TNFR superfamily, is a type I transmembrane protein containing 2 TNF receptor domains with a predicted molecular weight of approximately 30 kD. HVEM is widely expressed in blood vessels, brain, heart, kidney, liver, lung, prostate, spleen, thymus and other organs. Resting T cells and naïve and memory B cells express high levels of HVEM as well. In humans, HVEM is not expressed in germinal center B cells. Immature dendritic cells express high levels of HVEM that is downregulated upon maturation. HVEM plays an important role in herpes simplex virus pathogenesis by enhancing entry into cells. Signaling through HVEM activates JNK1, NF-κB and AP-1 to control gene expression in response to infection or cellular stress and activate the immune response. HVEM binds to LIGHT and has also been shown to associate with several other proteins including TRAF1, TRAF2, TRAF3, TRAF5, B and T lymphocyte associated protein (BTLA), and estrogen receptor alpha.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Recombinant human HVEM protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The 122 antibody has been shown to be useful for flow cytometry, Western blot, and ELISA.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Cheung TC, et al. 2010. J. Immunol. 185:1949. PubMed Hobo W, et al. 2012. J Immunol. 189:39. PubMed.
RRID: AB_2894618 (BioLegend Cat. No. 318821)
Structure: Member of the TNFR superfamily, type I transmembrane protein containing 2 TNF receptor domains. Predicted molecular weight approximately 30 kD.
Distribution: Widely expressed in blood vessels, brain, heart, kidney, liver, lung, prostate, spleen, thymus and other organs. Resting T cells and naïve and memory B cells express high levels of HVEM. Immature dendritic cells express high levels of HVEM that is downregulated upon maturation.
Function: Plays an important role in herpes simplex virus pathogenesis by enhancing entry into cells. Signaling through HVEM activates JNK1, NF-κB and AP-1 to control gene expression in response to infection or cellular stress and activate the immune response.
Interaction: TRAF1, TRAF2, TRAF3, TRAF5, B and T lymphocyte associated protein (BTLA), and estrogen receptor alpha have been shown to directly interact with HVEM in vivo.
Ligand/Receptor: LIGHT (TNFSF14), LTα
Cell Type: B cells, Dendritic cells, T cells
Biology Area: Cell Adhesion, Cell Biology, Immunology, Signal Transduction
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Carfi A, et al. 2001. Molec. Cell 8:169. 2. Gonzalez LC, et al. 2005.Proc. Nat. Acad. Sci. 102:1116. 3. Kwon BS, et al. 1997. J. Biol. Chem. 272:13471. 4. Marsters SA, et al. 1997. J. Biol. Chem. 272:14272. 5. Montgomery RI, et al. 1996. Cell 87:427.
Gene ID: 8764
UniProt: View information about CD270 on UniProt.org
Clone: 122
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: TR2, Herpesvirus entry mediator A, Tumor necrosis factor receptor superfamily, member 14, TNFRSF14, Tumor necrosis factor receptor like 2, HVEM
Isotype: Mouse IgG1, κ
Barcode Sequence: TGATAGAAACAGACC


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924