Biolegend, 323059, TotalSeq™-D0392 anti-human CD15 (SSEA-1) Antibody, 10μg

CD15 is 3-fucosyl-N-acetyllactosamine (3-FAL) also known as Lewis X, 3-FAL, X-hapten, and SSEA-1. CD15 is expressed on granulocytes and monocytes. It has also been shown to be expressed on Langerhans cells. CD15 has been implicated in adhesion as well as chemotaxis, phagocytosis, and bactericidal activity.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: WERI-RB-1 retinoblastoma cell line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
RRID: AB_2904344 (BioLegend Cat. No. 323059)
Structure: Poly-N-acetyllactosamine
Distribution: Neutrophils, eosinophils, monocytes
Function: Adhesion
Cell Type: Embryonic Stem Cells, Eosinophils, Neutrophils
Biology Area: Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family: CD Molecules
Antigen References: 1. Stocks SC, et al. 1990. Biochem. J. 268:275.
Gene ID: NA
Clone: W6D3
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: Lewis X, 3-FAL, 3-FL, LNFP III, Lex, SSEA-1, X-hapten
Isotype: Mouse IgG1, κ
Barcode Sequence: TCACCAGTACCTAGT