Biolegend, 324253, TotalSeq™-D0123 anti-human CD326 (Ep-CAM) Antibody, 10μg

CD326 is also known as Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, and TROP1. CD326 is a type I transmembrane protein containing six disulfide bridges and one THYRO domain. This cell surface glycosylated 40 kD protein is highly expressed in bone marrow, colon, lung, and most normal epithelial cells and is expressed on carcinomas of gastrointestinal origin. Recently, it has been reported that CD326 expression occurs during the early steps of erythrogenesis. CD326 functions as a homotypic calcium-independent cell adhesion molecule and is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation. CD326 antigen is an immunotherapeutic target for the treatment of human carcinomas.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: DU.4475 breast carcinoma
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the revelant formats) include: immunofluorescence, immunohistochemistry3, and spatial biology (IBEX)4,5.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Lammers R, et al. 2002. Exp. Hematol. 30:537. Schultz LD, et al. 2010. P. Natl. Acad. Sci. USA 107:13022. PubMed Human Protein Atlas http://www.proteinatlas.org/ENSG00000119888/antibody (IHC) Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2927878 (BioLegend Cat. No. 324253)
Structure: Type I transmembrane protein, contains six disulfide bridges, one THYRO domain, approximate molecular weight 40 kD.
Distribution: Highly expressed in bone marrow, colon, lung, and most normal epithelial cells. Also highly expressed on carcinomas of gastrointestinal origin. Expressed during early erythrogenesis.
Function: Homotypic calcium-independent cell adhesion. CD326 is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation.
Modification: Glycosylated.
Cell Type: Embryonic Stem Cells, Epithelial cells
Biology Area: Cell Biology, Immunology, Stem Cells
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Strnad J, et al. 1989. Cancer Res. 49:314. 2. Munz M, et al. 2004. Oncogene 23:5748. 3. Rao CG, et al. 2005. Int. J. Oncol. 27:49.
Gene ID: 4072
UniProt: View information about CD326 on UniProt.org
Clone: 9C4
Regulatory Status: RUO
Other Names: Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, TROP1
Isotype: Mouse IgG2b, κ
Barcode Sequence: TTCCGAGCAAGTATC