Biolegend, 331609, TotalSeq™-D0010 anti-human CD276 (B7-H3) Antibody, 10μg

B7-H3 is a member of the B7 gene family. It has 88% amino acid sequence identity with mouse B7-H3. It is mostly expressed on professional APCs, including B cells, macrophages, and dendritic cells. Its expression on dendritic cells appears to be up-regulated by LPS. B7-H3 protein inhibits T cell activation and cytokine production. It was reported that monoclonal antibody against B7-H3 enhanced T cell proliferation in vitro and led to exacerbated EAE in vivo. Therefore, B7-H3 may be a negative regulator on T cell activation and function.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
RRID: AB_2892401 (BioLegend Cat. No. 331609)
Structure: About 49.7 KD transmembrane protein characterized by extracellular IgV and IgC domains.
Distribution: B7-H3 is expressed on professional APCs, including B cells, dendritic cells, and macrophages. It is reported to express on a minor fraction of CD4+ and CD8+ cells.
Ligand/Receptor: The receptor has not been identified, but it seems to be expressed on activated T cells.
Bioactivity: B7-H3 is a negative regulator of T cell activation and IL-2 production.
Cell Type: Antigen-presenting cells, B cells
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Sun M, et al. 2002. J. Immunology. 168:6294 2. Xu J, et al. 2006. Cellular and Molecular Immunology. 3:235
Gene ID: 80381
UniProt: View information about CD276 on UniProt.org
Clone: DCN.70
Regulatory Status: RUO
Other Names: B7RP2
Isotype: Mouse IgG1, κ
Barcode Sequence: GACTGGGAGGGTATT