Iright
BRAND / VENDOR: Biolegend

Biolegend, 339029, TotalSeq™-D0246 anti-human CD122 (IL-2Rβ) Antibody, 10μg

CATALOG NUMBER: 339029
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD122 is a 70-75 kD type I transmembrane glycoprotein and member of the Ig superfamily. It is IL-2 receptor β chain also known as IL-2Rβ, which is also shared by the IL-15 receptor. CD122 is constitutively expressed by NK cells and at lower levels by a subset of T cells. Its expression is upregulated upon activation. The IL-2Rβ chain can combine with either the common γ subunit (γc, CD132) alone or with the γc subunit and the IL-2Rα subunit (CD25) to generate intermediate or high affinity IL-2 receptor complexes, respectively. CD122 expression levels can be upregulated by activation.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: TL-Mor cell line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications include (for the relevant formats) include: immunoprecipitation, blocking of IL-2 binding to CD122, and partial inhibition of IL-2 induced cell proliferation.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Takeshita T, et al. 1989. J. Exp. Med. 169:1323.
RRID: AB_2894591 (BioLegend Cat. No. 339029)
Structure: Ig superfamily, forms high affinity IL-2 receptor with CD25 and CD132 chains or intermediate affinity receptor with CD132 alone, 70-75 kD
Distribution: NK cells, T subset
Function: Critical component of IL-2 and IL-15 signaling
Ligand/Receptor: IL-2, IL-15
Cell Type: NK cells, T cells, Tregs
Biology Area: Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers Wiley-Liss A John Wiley & Sons Inc, Publication 2. Minami Y, et al. 1993. Annu. Rev. Immunol. 11:245. 3. Suzuki H, et al. 1995. Science 268:1472.
Gene ID: 3560
UniProt: View information about CD122 on UniProt.org
Clone: TU27
Regulatory Status: RUO
Workshop: V C050
Other Names: IL-2 Receptor β chain, IL-2Rβ
Isotype: Mouse IgG1, κ
Barcode Sequence: TCATTTCCTCCGATT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924