Iright
BRAND / VENDOR: Biolegend

Biolegend, 339705, TotalSeq™-D1279 anti-human CD300e (IREM-2, CMRF35-A5) Antibody, 10μg

CATALOG NUMBER: 339705
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

IREM-2 (immune receptor expressed by myeloid cells 2), also known as CMRF35-A5, LMIR6, CD300Le or CD300e, is a 34 kD type I single transmembrane glycoprotein. It is a member of the CD300 family and of the Ig-superfamily. IREM-2 is expressed on monocyte and myeloid dendritic cells, but not on granulocytes and lymphoid dendritic cells. IREM-2 is an activating receptor through interaction with DAP12.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: IREM-IgG fusion protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications include: immunoprecipitation and stimulation of TNF-a production by monocytes
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Aguilar H, et al. 2004. J. Immunol. 173:6703 Gasiorowski RE, et al. 2013. Immunol Lett. 149:93. PubMed
RRID: AB_2936672 (BioLegend Cat. No. 339705)
Structure: 34 kD, type I transmembrane glycoprotein, CD300 family, Ig superfamily
Distribution: Monocytes, macrophages, dendritic cells
Function: Activation of myeloid cells
Cell Type: Dendritic cells, Macrophages, Monocytes
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: 1. Aguilar H, et al. 2004. J. Immunol. 173:6703
Gene ID: 342510
UniProt: View information about CD300e on UniProt.org
Clone: UP-H2
Regulatory Status: RUO
Other Names: CD300e, CMRF35-A5, LMIR6
Isotype: Mouse IgG1, κ
Barcode Sequence: CTCAGTCAACCGTTT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924