Iright
BRAND / VENDOR: Biolegend

Biolegend, 347117, TotalSeq™-D0199 anti-human Siglec-8 Antibody, 10μg

CATALOG NUMBER: 347117
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Siglec-8 is a lectin specific for 6'-sulfo-sLe x and a member of the Ig-superfamily. It is expressed almost exclusively in eosinophils; however, basophils and mast cells can express it to a lower degree. Siglec-8 is a 54 kD transmembranal protein; the extracellular domain has one V-set Ig-like domain and two C2-set domains. The cytoplasmic domain has two immunoreceptor tyrosine-based inhibitor motifs (ITIM) that recruit SH2-family phosphatases after tyrosine phosphorylation. There are reports that siglec-8 inhibits the release of histamine and prostaglandin D2 mediated by the IgEFcR. This molelcule is also involved in the induction of apoptosis.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Recombinant Siglec-8 fused to human IgG Fc
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Floyd H, et al. 2000. J. Biol. Chem. 275:861. Wen T, et al. 2014. J Immunol. 192:5481. PubMed
RRID: AB_2904369 (BioLegend Cat. No. 347117)
Structure: A lectin of 54 kD, belonging to the Ig-superfamily; has one V-set Ig-like domain and two C2-set domains; has a single transmembrane domain, and two immunoreceptor tyrosine-based inhibitor motifs (ITIM) in the cytoplasmic domain
Distribution: Eosinophils, basophils, mast cells
Function: Cell adhesion, signal transduction
Interaction: Phosphatases containing a SH2 domain
Bioactivity: Inhibition of IgE receptor-triggered histamine and prostaglandin D2 release, apoptosis
Cell Type: Basophils, Eosinophils, Mast cells
Biology Area: Cell Adhesion, Cell Biology, Immunology, Signal Transduction
Molecular Family: Adhesion Molecules, Siglec Molecules
Antigen References: 1. Bochner BS, et al. 2009. Clin. Exp. Allergy. 39:317. 2. Hudson SA, et al. 2009. J. Pharmacol. Exp. Ther. 330:608. 3. Nutku E, et al. 2005. Biochem. Biophys. Res. Commun. 336:918.
Gene ID: 27181
UniProt: View information about Siglec-8 on UniProt.org
Clone: 7C9
Regulatory Status: RUO
Other Names: Sialic acid-binding Ig-like lectin 8 (Siglec-8), Siglec8L, Sialoadhesin family member 2 (SAF2)
Isotype: Mouse IgG1, κ
Barcode Sequence: CTTCTCCTCAGCAAT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924