Iright
BRAND / VENDOR: Biolegend

Biolegend, 350621, TotalSeq™-D0185 anti-human CD11a Antibody, 10μg

CATALOG NUMBER: 350621
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD11a is a 170-180 kD type I transmembrane glycoprotein also known as LFA-1α chain and integrin α L subunit. CD11a non-covalently associates with integrin β 2 (CD18) to form LFA-1. It is expressed on all leukocytes, including B and T lymphocytes, monocytes, macrophages, neutrophils, basophils and eosinophils. It is absent on non-hematopoietic tissues and platelets. CD11a plays a central role in leukocyte cell-cell interactions and is important in lymphocyte costimulation. CD11a/CD18 binds to ICAM-1 (CD54), ICAM-2 (CD102), and ICAM-3 (CD50).
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: HLA-DR CTL line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for relevant formats) include: immunoprecipitation1, 2. Note: the antibody TS2/4 recognizes the ß-propeller domain of CD11a and only immunoprecipitates the CD11a/CD18 complex.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Huang C and Springer TA. 1997. P. Natl. Acad. Sci. USA 94:3162. (IP) Sanchez-Madrid F, et al. 1983. J. Exp. Med. 158:1785. (IP) Sanchez-Madrid F, et al. 1982. P. Natl. Acad. Sci. USA 79:7489. (FC)
RRID: AB_2892426 (BioLegend Cat. No. 350621)
Structure: Integrin, type I transmembrane glycoprotein, noncovalently linked with integrin β2 (CD18) forms LFA-1, 170-180 kD
Distribution: Leukocytes
Function: Adhesion, costimulation
Ligand/Receptor: ICAM-1(CD54), ICAM-2(CD102), ICAM-3(CD50)
Cell Type: Leukocytes, Tregs
Biology Area: Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Lub M, et al. 1995. Immunol. Today 16:479. 2. Parsons J. 1996. Curr. Opin. Cell Biol. 8:146.
Gene ID: 3683
UniProt: View information about CD11a on UniProt.org
Clone: TS2/4
Regulatory Status: RUO
Workshop: V S160
Other Names: LFA-1α chain, αL Integrin, Lymphocyte function-associated antigen 1, LFA-1α chain, ITGAL
Isotype: Mouse IgG1, κ
Barcode Sequence: TATATCCTTGTGAGC


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924