Iright
BRAND / VENDOR: Biolegend

Biolegend, 351371, TotalSeq™-D0390 anti-human CD127 (IL-7Rα) Antibody, 10μg

CATALOG NUMBER: 351371
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD127 is a 60-90 kD type I transmembrane glycoprotein also known as IL-7 receptor α chain or IL-7Rα. It forms a heterodimer with the common γ chain (γc or CD132) which is shared with the receptors for IL-2, IL-4, IL-9, IL-13, IL-15, and IL-21. CD127 is expressed on immature B cells through early pre-B stage cells, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, and bone marrow stromal cells. CD127 has been reported to be a useful marker for identifying memory and effector T cells. Studies have shown that CD127 expression is down-modulated on Treg cells. It can be used as a marker for differentiation of Treg and conventional T cells. The ligation of IL-7 with its receptor is important for stimulation of mature and immature T cells as well as immature B cell proliferation and development.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Recombinant human CD127
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported (for the relevant formats) application: proteogenomics1.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID: AB_2892428 (BioLegend Cat. No. 351371)
Structure: Type I transmembrane glycoprotein, associates with CD132, 60-90 kD
Distribution: Immature B cells through early pre-B stage, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, bone marrow stromal cells
Function: T cell and immature B cell proliferation and development
Ligand/Receptor: IL-7
Cell Type: B cells, T cells, Thymocytes, Tregs
Biology Area: Immunology
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Sudo T, et al. 1993. P. Natl. Acad. Sci. USA 90:9125. 2. He YW and Malek TR. 1998. Crit. Rev. Immunol. 18:503. 3. Huster KM, et al. 2004. P. Natl. Acad. Sci. USA 101:5610. 4. Pillai M, et al. 2004. Leukemia Lymphoma 45:2403. 5. Morrissey PJ, et al. 1989. J. Exp. Med. 169:707. 6. Liu W, et al. 2006. J. Exp. Med. 203:1701.
Gene ID: 3575
UniProt: View information about CD127 on UniProt.org
Clone: A019D5
Regulatory Status: RUO
Other Names: IL-7 receptor α chain, IL-7Rα
Isotype: Mouse IgG1, κ
Barcode Sequence: GTGTGTTGTCCTATG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924