Product Description
CD371 (CLEC12A), also known as DCAL-2, MICL or CLL-1, is a 30 kD type II transmembrane protein with extracellular C-type lectin domains, belonging to the C-type lectin family. It is expressed on monocytes, granulocytes, NK cells, and basophils. Its cytoplasmic ITIM motif modulates signaling cascades and is involved in phosphorylation of tyrosine residues in MAP kinases.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: 293T cells expressing CLEC12A-Flag
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Lahoud MH, et al. 2009. J. Immunol. 182:7587. (FC) Lahoud MH, et al. 2011. J. Immunol. 187:842. (FC) Neumann K, et al. 2014. Immunity. 40:389. PubMed
RRID: AB_2904374 (BioLegend Cat. No. 353617)
Structure: Type II C-type lectin family member, 265 aa, 30.7 kD
Distribution: Monocytes, granulocytes, NK cells, and basophils
Function: Negative regulator of granulocyte and monocyte function
Interaction: PTPN6 and PTPN11
Cell Type: Basophils, Dendritic cells, Granulocytes, Monocytes, NK cells
Biology Area: Immunology, Costimulatory Molecules
Molecular Family: CD Molecules
Antigen References: 1. Lahoud MH, et al. 2009. J. Immunol. 182:7587. 2. Chen CH, et al. 2006. Blood 107:1459. 3. Marshall AS, et al. 2004. J. Biol. Chem. 279:14792.
Gene ID: 160364
UniProt: View information about CD371 on UniProt.org
Clone: 50C1
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: CLL1, MICL, CLL-1, DCAL-2, C-type lectin domain family 12 member A, CD371
Isotype: Mouse IgG2a, κ
Barcode Sequence: CATTAGAGTCTGCCA
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924