Biolegend, 354537, TotalSeq™-D0406 anti-human CD304 (Neuropilin-1) Antibody, 10μg

CD304, also known as neuropilin-1, BDCA-4 and VEGF165R, is a 140 kD type I transmembrane protein. Its extracellular region contains 2 CUB, 2 FV/FVIII, and one MAM domain; a soluble isoform is produced by alternative mRNA splicing. CD304 is involved in angiogenesis, neural development, and tumor metastasis. It's expressed by plasmacytoid dendritic cells, thymocytes, neurons, endothelium, and a subset of T FH cells. CD304 is also expressed in several carcinomas, and a high expression of this molecule in prostate cancer correlates with a poor prognosis.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: CD304-Fc Fusion protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2894620 (BioLegend Cat. No. 354537)
Structure: Type I transmembrane protein, 140 kD, 2 complement binding domains (CUB), 2 coagulation factor V/VIII homology domains (FV/FVIII), one meprin, A5, receptor tyrosine phosphatase domain (MAM)
Distribution: Plasmacytoid dendritic cells, thymocytes, subset of follicular helper T cells (TFH), endothelial cells, neurons, some carcinomas
Function: Angiogenesis, neuronal development, tumor metastasis
Ligand/Receptor: VEGF165, semaphorin-3A
Cell Type: Dendritic cells, Endothelial cells, Neurons, Tfh, Thymocytes
Biology Area: Angiogenesis, Cell Adhesion, Cell Biology, Immunology, Innate Immunity, Neuroscience, Synaptic Biology
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Mizui M and Kikutani H. 2008. Immunity 28:302. 2. Hamerlik P, et al. 2012. J. Exp. Med. 209:507. 3. Karjalainen K, et al. 2011. Blood 117:920. 4. Lepelletier Y, et al. 2007. P. Natl. Acad. Sci. USA 104:5545.
Gene ID: 8829
UniProt: View information about CD304 on UniProt.org
Clone: 12C2
Regulatory Status: RUO
Other Names: BDCA-4
Isotype: Mouse IgG2a, κ
Barcode Sequence: GGACTAAGTTTCGTT