Biolegend, 355127, TotalSeq™-D0027 anti-human CD70 Antibody, 10μg

CD70, also known as CD27L, is a 50 kD type II transmembrane glycoprotein and member of the tumor necrosis factor superfamily. CD70 is expressed on activated T, B and NK cells, activated plasmacytoid dendritic cells (pDCs), and chronic B cell lymphocytic leukemia and large B cell lymphomas. CD70 costimulates T cell proliferation and differentiation. It plays a role in the pDC-induced B cell differentiation. The ligand of CD70 is CD27.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: CD70-transfected L cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications for the relevant formats include: blocking of plasmacytoid dendritic cell induced B cell proliferation and Ig secretion1.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Shaw J, et al. 2010. Blood 115:3051. (Block)
RRID: AB_2922571 (BioLegend Cat. No. 355127)
Structure: Type II transmembrane glycoprotein, member of the tumor necrosis factor superfamily, 50 kD
Distribution: Activated T cells and B cells, activated NK cells, activated plasmacytoid dendritic cells, some B cell lymphomas
Function: Role in T cell proliferation, generation of cytolytic and memory T cells, B cell proliferation and differentiation
Ligand/Receptor: CD27
Cell Type: B cells, Dendritic cells, NK cells, T cells
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Bowman MR, et al. 1994. J. Immunol. 152:1756. 2. Shaw J, et al. 2010. Blood 115:3051. 3. Keller AM, et al. 2009. Blood 113:5167.
Gene ID: 970
UniProt: View information about CD70 on UniProt.org
Clone: 113-16
Regulatory Status: RUO
Other Names: CD27 ligand, CD27L, Ki-24 antigen, Tumor necrosis factor ligand superfamily, member 7 (TNFSF7)
Isotype: Mouse IgG1, κ
Barcode Sequence: CGCGAACATAAGAAG