Iright
BRAND / VENDOR: Biolegend

Biolegend, 356211, TotalSeq™-D0865 anti-human VEGFR-3 (FLT-4) Antibody, 10μg

CATALOG NUMBER: 356211
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Receptor tyrosine Kinase VEGFR-3, also known as FLT4, together with VEGFR1 (FIT1) and VEGFR2 (KDR/Flk-1), are the receptors for vascular endothelial growth factors (VEGF). The VEGFR family belongs to the class II subfamily of receptor tyrosine kinases (RTKs), containing a large extracellular region which is composed of seven Ig-like domains (D1–D7), a single transmembrane, helix, and a cytoplasmic region with tyrosine kinase activity. In VEGFR-3, the fifth Ig homology domain is proteolytically cleaved which results in polypeptides that remain linked by two disulfide bonds. VEGFR-3 is widely expressed on all endothelial cells in early embryogenesis, while, in adult tissues, VEGFR-3 expression disappears from the vascular endothelial cells and is observed only on the lymphatic endothelium. VEGF-C and VEGF-D activation of VEGFR-3 plays an important role in the formation of the lymphatic vessel system. Aberrant activation or expression of VEGFR and their ligands has been implicated in tumor angiogenesis, coronary artery disease, diabetic blindness, and other diseases.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: VEGFR extracellular domain protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for relevant formats) include: immunohistochemistry staining of frozen or paraffin embedded sections1-3.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Jussila L, et al. 1998. Cancer Res. 58:1599. (IHC) Kilic N, et al. 2007. Blood 110:4223. (IHC) Folpe A, et al. 2000. Mod. Pathol. 13:180. (IHC)
RRID: AB_3675079 (BioLegend Cat. No. 356211)
Structure: Seven Ig-like domains in the extracellular domain, a single transmembrane helix, and a cytoplasmic region with tyrosine kinase activity
Distribution: Widely expressed in early embryogenesis endothelial cells, restrictly expressed on lymphatic endothelial cells in adults
Function: Mediates lymphangiogenesis in response to VEGF-C and VEGF-D, involved in cardiovascular development during embryogenesis
Ligand/Receptor: VEGF-C, VEGF-D
Biology Area: Cell Biology, Immunology, Signal Transduction
Molecular Family: Cytokine/Chemokine Receptors
Antigen References: 1. Tammela T, et al. 2008. Nature 454:656. 2. Partanen TA, et al. 2000. FASEB J. 14:2087. 3. Valtola R, et al. 1999. Am. J. Pathol. 154:1381. 4. Jussila L, et al. 1998. Cancer Res. 58:1599. 5. Galland F, et al. 1992. Genomics 13:475.
Gene ID: 2324
UniProt: View information about VEGFR-3 on UniProt.org
Clone: 9D9F9
Regulatory Status: RUO
Other Names: Receptor tyrosine Kinase VEGFR-3, VEGFR3, FLT4
Isotype: Mouse IgG1, κ
Barcode Sequence: TGATCCGAAGTCGTG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924