Product Description
HLA-DR, HLA-DP, and HLA-DQ are heterodimeric cell surface glycoproteins comprised of an α (heavy) chain and a β (light) chain. They are expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In conjunction with the CD3/TCR complex and CD4 molecules, HLA-DR is critical for efficient peptide presentation to CD4+ T cells. Variations in the HLA gene expression are crucial to graft survival.
10μg
Verified Reactivity: Human
Reported Reactivity: Baboon, Cynomolgus, Cat, Dog, Cow
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human PBL
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Tü39 has been reported to react with a shared epitope of HLA-DR, HLA-DP, and HLA-DQ. Additional reported applications (of relevant formats) include immunoprecipitation6, in vitro blocking of MLR5, and suppressor cell generation4. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (contact our custom solutions team).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Pawelec G, et al. 1985. Hum. Immunol. 12:165. Shaw S, et al. 1985. Hum. Immunol. 12:191. Ziegler A, et al. 1986. Immunobiology 171:77. Pawelec G, et al. 1986. Hum. Immunol. 17:343. (Block) Dai Z, et al. 2009. J. Exp. Med. 206:793. (Block) Pawelec G, et al. 1988. J. Exp. Med. 167:243. (IP)
RRID: AB_2922573 (BioLegend Cat. No. 361719)
Structure: Ig superfamily, MHC class II, heterodimeric transmembrane protein
Distribution: B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs
Function: Antigen presentation
Ligand/Receptor: CD3/TCR, CD4
Cell Type: Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells
Biology Area: Immunology, Innate Immunity
Molecular Family: MHC Antigens
Antigen References: 1. Thorsby E. 1974. Transplant. Rev. 18:51. 2. Qvigstad E, et al. 1984. Hum. Immunol. 11:207. 3. Servenius B, et al. 1984. EMBO J. 3:3209. 4. Ottenhoff TH, et al. 1985. Hum. Immunol. 13:105. 5. Strassmann G, et al. 1985. Hum. Immunol. 13:125. 6. Trowsdale J, et al. 1985. Immunol Rev. 85:5.
Gene ID: 312231233113311531173119
UniProt: View information about HLA-DR DP DQ on UniProt.org
Clone: Tü39
Regulatory Status: RUO
Other Names: MHC class II, Major Histocompatibility complex II, human leukocyte antigen, HLA
Isotype: Mouse IgG2a, κ
Barcode Sequence: AGCTACGAGCAGTAG
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924