Iright
BRAND / VENDOR: Biolegend

Biolegend, 399809, TotalSeq™-D1278 anti-human CD200 (OX2) Antibody, 10μg

CATALOG NUMBER: 399809
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD200, also known as OX2, is a member of the immunoglobulin superfamily (IgSF). It is a monomorphic cell surface glycoprotein that is expressed on thymocytes, neurons, endothelium, follicular dendritic cells in all lymphoid organs, a subset of CD34+ progenitor cells, and at low levels on some smooth muscle and B lymphocytes. It is not expressed on NK cells, monocytes, granulocytes, or platelets. CD200 costimulates T cell proliferation. It may regulate myeloid cell activity in a variety of tissues. The interaction between CD200 (OX2) and CD200 receptor (OX2R) system is of importance in the control of macrophage and granulocyte activation, which may contribute to pathways that suppress and limit macrophage induced inflammatory damage in tissue.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Recombinant human CD200
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone A18042B antibody is able to completely block the staining of OX-104 antibody, but OX-104 antibody does not completely block the staining of A18042B antibody.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2936583 (BioLegend Cat. No. 399809)
Structure: Ig superfamily, 80 kD
Distribution: T cells, neurons, endothelium
Function: Costimulates T cell proliferation
Ligand/Receptor: CD200R
Cell Type: Endothelial cells, Neurons, T cells
Biology Area: Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family: CD Molecules
Antigen References: Wright GJ, et al. 2001. Immunology. 102:173. Foster-Cuevas M, et al. 2004. J. Virol. 78:7667. Mason D, et al. 2002. ed. Leukocyte Typing VII. New York:Oxford Univ. Press. Broderick C, et al. 2002. Am. J. Pathol. 161:1669.
Gene ID: 4345
UniProt: View information about CD200 on UniProt.org
Clone: A18042B
Regulatory Status: RUO
Other Names: OX-2, OX2
Isotype: Mouse IgG1, κ
Barcode Sequence: AGTCCTCAGTATCCT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924