Product Description
The Epimark Related Categories Enrichment,, Epitranscriptome Analysis,, Methylome Analysis, Specification Materials Required but not Supplied Reaction Buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40 in nuclease free H 2 O) Protein G Magnetic Beads (NEB #S1430) Magnetic Racks for bead separations (NEB #S1506 or #S1509) Monarch ® RNA Cleanup Kit (10 µg) ( NEB #T2030 ) 100% Ethanol 70% Ethanol Eppendorf ® RNA/DNA LoBind microcentrifuge tubes (Sigma catalog #Z666548) or equivalent RNase-free pipette tips Powder-free gloves Nuclease-free water Optional Materials Primers for amplification of control RNAs: GLuc Forward Primer = 5´- CGACATTCCTGAGATTCCTGG - 3´ GLuc Reverse Primer = 5´- TTGAGCAGGTCAGAACACTG - 3´ CLuc Forward Primer = 5´- GCTTCAACATCACCGTCATTG - 3´ CLuc Reverse Primer = 5´- CACAGAGGCCAGAGATCATTC - 3´ ProtoScript ® II First Strand cDNA Synthesis Kit (NEB #E6560) Bio-Rad iTaq™ Universal SYBR ® Green Supermix (cat. #172-5120) 384 well PCR plate (Bio-Rad cat. #HSP-3805) Optical film (Bio-Rad cat. #MSB-1001) FAQ Q: How much of the control RNAs should I use if I want to spike them into my sample? A: If you intend to spike the control RNAs into your sample it is essential to use a much smaller quantity than when doing a control IP on them alone. This is because the m6A control RNA is highly modified and the antibody has a high affinity for it. This will result in the m6A control RNA becoming predominant in the sample after IP. Use of 1 µl of a 1:1000 dilution of each control RNA (0.1 fmol of each RNA) is recommended. The control RNAs can be spiked in either before or after fragmentation of the RNA sample. If spiked in after, a concentrated stock of the control RNAs should be fragmented and then diluted prior to addition to the sample. Q: Will the antibody bind m6A-containing DNA? A: The antibody has not been tested much on DNA substrates but it is very likely that it will work well on single stranded DNA that contains m6A. It is possible that it may bind double stranded DNA that contains m6A as well but the affinity might be significantly lower than single stranded substrates. Q: What is the protein concentration of the N6-Methyladenosine Antibody? A: The antibody is formulated based on activity and the concentration may be adjusted between lots to get optimal results. The kit contains 20 µl of antibody sufficient for 10 X 2 round immunoprecipitations. Q: I did not get enough yield of RNA for my downstream application after two rounds of IP. How do I increase the yield? A: One way to increase recovery of RNA is to do one round of IP instead of two. One round typically generates enough enrichment of m6A containing RNA. Alternatively, the IP can be done with 2, 3, or 4 µl of antibody per round for 1 or 2 rounds. The use of extra antibody will result in more RNA to be recovered and the amount of enrichment will still be significant. However, use of >4 µl antibody might cause the enrichment to go down because a significant amount of unmodified RNA will also be recovered. Q: What method do you recommend for RNA fragmentation? A: We recommend using the NEBNext® Magnesium RNA Fragmentation Module (NEB Catalog # E6150S) for this purpose. However, any established RNA fragmentation protocol will work provided it results in RNA compatible with the application downstream of the enrichment. It is recommended that the RNA is cleaned up using spin columns or phenol chloroform-extraction, ethanol precipitation post fragmentation.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924