Product Description
The EnGen sgRNA Synthesis Kit, Related Categories sgRNA Synthesis Specification Materials Required but not Supplied Target-specific DNA oligo(s) Thermocycler/37°C heat block/incubator Nuclease-free water Equipment and reagents for RNA quantitation Spin columns for RNA cleanup (e.g. NEB #T2040 ) RNase-free tubes, aerosol tips Microcentrifuge Optional Materials: Alkaline Phosphatase, Calf Instestinal (CIP) Cas9 Nuclease, S. pyogenes EnGen Spy Cas9, NLS Gels, running buffer, gel loading dye, RNA and DNA ladders, gel box FAQ Q: Is it necessary to add a “G” into the oligo following the T7 promoter sequence? A: At least one G, directly downstream of the “TATA” of the T7 promoter sequence is required for efficient transcription. This G will be the +1 of the transcript. If the 20 nucleotide target-specific sequence selected has a G at the 5’ end of the 20 nucleotides then it is not necessary to add an additional G as the G within the target-specific sequence will serve as the +1. Q: Is it necessary to DNase treat my sgRNA synthesis reaction? A: We recommend DNAse treating the sgRNA synthesis reaction with 2µl of the provided DNaseI (RNase-free) for 15 minutes at 37°C followed by spin column purification. Removal of DNA template, and leftover NTPs and dNTPs, will result in a more reliable measurement of RNA yield as instruments that read A260 (such as a traditional UV spectrophotometer or NanoDrop™) will read both RNA and DNA and will not give a reliable concentration. It is important to consider how leftover template, dNTPs and NTPs may affect downstream applications. Q: Why is my sgRNA not exhibiting 100% in vitro Cas9 cleavage activity? A: We recommend using target prediction websites to help identify optimum sequences for gene targeting through Cas9. Please refer to the Cas9 product page (NEB #M0386 or NEB #M0641 (NLS)) for protocol information. For general information on Genome Editing and planning experiments utilizing NEB products, please see: https://www.neb.com/applications/cloning-and-synthetic-biology/genome-editing Q: Is it necessary to phosphatase treat my sgRNAs? A: RNAs transcribed with a bacteriophage polymerase will possess 5’ triphosphates. Phosphatase treatment will remove these triphosphates leaving a 5’ OH. If treating with phosphatase we recommend treatment following DNaseI treatment. The enzyme can not be inactivated by heat, therefore phenol:chloroform extraction is the preferred method for inactivating the enzyme. Q: Will the sgRNAs synthesized from this kit (NEB #E3322S) be recognized by homologs of Cas9 from different organisms? A: No. The sgRNAs synthesized from this kit contain the tracrRNA sequence that is specifically recognized by S. pyogenes Cas9 Q: Do I include the PAM(NGG) in my sgRNA sequence? A: When Cas9 binds to the sgRNA, a complex is formed which is then directed to bind to the target DNA when a PAM(NGG) site is present directly downstream of the 20nt target sequence in the DNA. The PAM is required to be present on the target strand for the Cas9 complex to recognize and bind to the DNA. It is not part of the guide RNA sequence and should not be included in the oligo when designing sgRNAs. Q: What is the sequence of the control oligo provided with the EnGen sgRNA Synthesis Kit, S. pyogenes? A: The sequence of the control oligo is: 5’ TTCTAATACGACTCACTATAGGCATCCTCGGCACCGTCACCCGTTTTAGAGCTAGA 3’ The final sequence of the control sgRNA synthesized using the kit would be: GGCAUCCUCGGCACCGUCACCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU The sgRNA synthesized from the control oligo targets pBR322 (NEB #N3033, bases 112-131). The complete plasmid sequence can be found here. Incubating the control sgRNA complexed to S. pyogenes Cas9 in the presence of PvuII-linearized pBR322 plasmid as the target (4361 bp) results in cleavage products of 2423 and 1938 bp (see Figure 6, manual). Alternatively, uncut (supercoiled) plasmid can be used as a template. On an agarose gel compared to uncut template, the plasmid cut by Cas9 will migrate slower (run higher) than the supercoiled plasmid. The target sequence for the control sgRNA is: 5’ CATCCTCGGCACCGTCACCC 3’ This sequence is within the tetR(C) gene on the pBR322 plasmid and may be present in other cloning vectors, though the exact sequence in the target should be verified as tetR may be in the opposite orientation or may contain the sequence of another class of tetR genes. Q: Is the Monarch Spin RNA Cleanup Kit (NEB #T2040) compatible with the EnGen sgRNA Synthesis Kit, S. pyogenes? A: Yes, sgRNAs synthesized using the EnGen sgRNA Synthesis Kit, S. pyogenes (NEB #E3322) can be cleaned up using the Monarch Spin RNA Cleanup Kit (50 µg, NEB #T2040) prior to the formation of ribonucleoprotein (RNP) complexes and subsequent electroporation into cells. Q: Is it necessary to add the provided DTT to the sgRNA synthesis reaction? A: Yes. We have included a vial of 0.1 M DTT as we find that it results in more consistent performance and yields of RNA. Please refer to the updated protocol and manual.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924