Product Description
NEBNext LV Unique Dual Index Primers Set 2A includes 24 unique pairs of i5 and i7 index primers optimized for low-volume (LV) NEBNext workflows, including NEBNext EM-seq™ v2, E5hmC-seq™, and NEBNext Low-bias Small RNA Library Prep Kit, with Illumina Related Categories NEBNext® Multiplex Oligos (Adaptors & Primers),, Next Generation Sequencing Library Preparation FAQ Q: What is the difference between NEBNext® Primers for Epigenetics and NEBNext LV Unique Dual Index Primers? A: The names “NEBNext Primers for Epigenetics” and “NEBNext LV Unique Dual Index Primers” refer to the same product family of low-volume UDI primers. All new products in this family will share the “NEBNext LV Unique Dual Index” name structure, whereas remaining products with the “Primers for Epigenetics” name structure (NEB #E3392 and #E3404) will be renamed by early 2025. When renamed, the products will retain their original product number (NEB #) For ease of reference, please refer to the following conversion table: NEB #: Original Name: Final Name: E3400 N/A NEBNext LV Unique Dual Index Primers Set 1 E3402 N/A NEBNext LV Unique Dual Index Primers Set 2 E3390 N/A NEBNext LV Unique Dual Index Primers Set 2A E3392 NEBNext Primers for Epigenetics (Unique Dual Index Set 2B) NEBNext LV Unique Dual Index Primers Set 2B E3404 NEBNext Primers for Epigenetics (Unique Dual Index Set 3) NEBNext LV Unique Dual Index Primers Set 3 E3406 N/A NEBNext LV Unique Dual Index Primers Set 4 E3408 N/A NEBNext LV Unique Dual Index Primers Set 5 Q: Are Sample Sheets available for use with the NEBNext® LV Unique Dual Index Primers Sets 1-5? A: Sample sheets are available and can be found under the Usage Guidelines section of each primer set’s product page. Q: Are libraries that have been dual indexed using the NEBNext® LV Unique Dual Index Primers compatible with single-end sequencing? A: Yes, libraries generated with the NEBNext LV Unique Dual Index Primers are compatible with single-read sequencing. Please refer to Illumina’s Indexed Sequencing Overview Guide (current version) for details on dual-indexed sequencing workflows on a single-read flow cell or a paired-end flow cell. Q: How many primer pairs are available in the NEBNext® LV Unique Dual Index Primer Pairs Sets 1-5? A: The NEBNext LV Unique Dual Index (UDI) Primers are available in two plate formats/sizes: An entire 96-well plate and a 96-well plate with 24 wells filled. In total, there are 480 unique primer pairs available. The following sets are available as 96 reactions in a 96-well plate: Set 1 (NEB #E3400) Set 2 (NEB #E3402) Set 3 (NEB #E3404) Set 4 (NEB #E3406) Set 5 (NEB #E3408) The following sets are available as 24 reactions in a 96-well plate: Set 2A (NEB #E3390) Set 2B (NEB #E3392) Note: Sets 2A and 2B are subsets of Set 2, and therefore are not recommended for use with Set 2; Set 2A and 2B may be combined for a total of 48 UDIs. Q: Can the NEBNext® LV Unique Dual Index Primers be used to address “index hopping” with Illumina® patterned flow cells? A: Yes. The Unique Dual Index (UDI) Primer Pairs were designed to facilitate sequencing on patterned flow cells for the Illumina instruments where index hopping is problematic. The unique combinations of dual indices allow the identification and complete filtering of index-swapped reads. Q: Are the NEBNext® LV Unique Dual Index Primers the same as NEBNext Multiplex Oligos for Illumina®? A: No. The volume of the NEBNext LV Unique Dual Index Primers has been optimized for use with use with newer library prep kits, including the NEBNext Enzymatic 5hmC-seq Kit (NEB #E3350) and NEBNext Enzymatic Methyl-seq Kit V2 (NEB #E8015). NEBNext LV Unique Dual Index Primers products do not include an adaptor, and the required adaptor is supplied in compatible library prep kits. The i5 and i7 unique dual indices associated with individual wells for the NEBNext LV Unique Dual Index Primers Set 3 (NEB #E3404S) are the same as those within the 96-well plate format of NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 3) (NEB #E6444). The indices in NEBNext LV Unique Dual Index Primers Set 2B (NEB #E3392S) are a subset of NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2) (NEB #E6442). Q: Are the NEBNext® LV Unique Dual Index Primers validated for the EM-seq™ v2 or E5hmC-seq™ workflows? A: Yes. The LV (low volume) index primers are extensively tested to ensure optimal performance with library prep kits that call for them. This includes EM-seq v2 and E5hmC-seq. Q: What is the concentration of the Index Primers in NEBNext® LV Unique Dual Index Primers? A: The NEBNext LV Unique Dual Index Primers are provided at a 10 µM concentration. Q: How many reactions’ worth of primer are in each well of the NEBNext® LV Unique Dual Index Primers? A: The NEBNext LV Unique Dual Index Primers plates were designed to be single-use. Although there is enough primer in each well for only one reaction, excess primer is provided to ensure sufficient amounts. We strongly recommend not using any leftover primer to avoid cross contamination with other indexed primers. Q: Can I use the 96-well primer plate supplied with the NEBNext LV Unique Dual Index Primers to do my PCR reactions? A: No, we do not recommend using the 96-well plate that the primers are packaged in. Although there is enough primer in each well for only one reaction, we provide excess primer to ensure sufficient amounts. This excess primer may result in primer-dimer formation during PCR. Q: Do I need to spike in custom sequencing primers when sequencing libraries made with NEBNext® LV Unique Dual Index Primers on Illumina® sequencing instruments? A: No. Libraries made using NEBNext LV Unique Dual Index Primers are fully compatible with Illumina sequencing protocols for TruSeq® HT libraries. For HiSeq®, HiScan®SQ, or GAIIx systems on single-read flow cells, the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (Illumina catalog # FC-121-1003) will need to be ordered separately when using both indices. This add-on box is not required with the MiSeq® System or on paired-end flow cells for HiSeq, HiScanSQ, GAIIx. Please refer to the Illumina website for complete information. Q: Can I perform single read runs and still get both index sequences? Can I run both single read and paired-end recipes with dual-indexed libraries? A: Yes. Please select the appropriate workflow based on the flow cell type (Single Read or Paired End) when starting your run so that the correct chemistry is used. If using a single-read flow cell the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (catalog #FC-121-1003) is necessary in order to sequence both index reads. Adapted from Illumina website. Q: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument? A: The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq: Adaptor Read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Adaptor Read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Q: What do I do if I received an index collision/barcode collision error? A: If you received an index collision error when demultiplexing the NEBNext Multiplex Oligos, upgrade to: Software Version Bclconvert 4.1.7 or later Bcl2fastq Any version Picard IlluminaBasecallsToSam Any version Reach out to Technical Support if you have more questions.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924