New England Biolabs, E3420S, NEBNext® Low-bias Small RNA Library Prep Kit

When seeing the full picture of small RNA species in a sample matters, there is only one library prep kit that truly delivers on the promise of being low bias. The NEBNext Low-bias Small RNA Library Prep Kit was designed to generate libraries that accurately reflect the relative proportions of RNA species present in a sample. The straightforward gel-free protocol with a wide input range makes this kit the fastest high-sensitivity kit for small RNA library prep on the market. Related Categories Small RNA Library Preparation ,, Next Generation Sequencing Library Preparation FAQ Q: What is the formulation of 0.1X TE provided with the NEBNext Low-bias Small RNA Library Prep Kit? A: The 0.1X TE supplied with the kit is 1 mM Tris-HCl, pH 8.0, 0.1 mM EDTA. Q: Are libraries generated with the NEBNext Low-bias Small RNA Library Prep Kit compatible with paired-end Illumina sequencing? A: Yes, libraries prepared with this protocol can be sequenced with paired-end reads. However, due to the small insert sizes, a single-end read of 56 bp is usually sufficient, and a second read would be redundant. Q: What are the sequences needed to trim the NEBNext Low-bias Small RNA libraries? A: The following sequences can be used to trim NEBNext Low-bias Small RNA libraries: Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Q: Are custom sequencing primers needed for sequencing NEBNext Low-bias Small RNA libraries? A: No. NEBNext Low-bias Small RNA libraries are compatible with Illumina sequencing reagents; therefore, design of custom primer sequences is unnecessary. Q: When is the RT primer annealed during the NEBNext Low-bias Small RNA Library Prep workflow (NEB #E3420)? A: There is no separate RT primer in the NEBNext Low-bias Small RNA Library Prep Kit. The RT primer is generated from the bottom strand of the NEBNext LB 3' Adaptor during the NEBNext LB 5' Adaptor Ligation reaction step. Q: What should I do if my RNA does not have 5' monophosphate and 3' OH ends before starting the NEBNext Low-bias Small RNA Library Prep workflow (NEB #E3420)? A: T4 PNK can add 5' monophosphate to a 5' OH and remove 3' phosphate generating a 3' OH. Other modifications such as caps or pyrophosphates would need to be removed with other enzymes, contact NEB technical support (info@neb.com) for recommendations. Q: Is it possible to prevent abundant, unwanted RNAs from being included in NEBNext Low-bias Small RNA libraries (NEB #E3420)? A: The NEBNext Low-bias Small RNA Library Prep Kit will capture all small RNAs less than ~ 120 nt that have 5' monophosphate and 3' OH ends, regardless of their origin. Q: Can I use total RNA as input into NEBNext Low-bias Small RNA Library Prep Kit (NEB #E3420), or do I need to isolate or enrich specifically for small RNAs? A: Both total RNA and enriched small RNA can be used as inputs into the NEBNext Low-bias Small RNA Library Prep Kit. Q: What are typical yields for a NEBNext Low-bias Small RNA library (NEB #E3420)? A: In general, commercially available total RNA from human brain (RIN > 7; 1000 ng; 9 PCR cycles) brought through Section 8A of the Product Manual (Size Selection) can yield 30 – 60 nM final libraries, while the same input brought through Section 8B of the Product Manual (Cleanup) can yield 60 – 120 nM final libraries. Factors such as sample, small RNA content, RNA integrity, and PCR cycle number will impact final library yields. Q: How important is the volume of isopropanol in the NEBNext Low-bias Small RNA Library Prep Kit (NEB #E3420) protocol? A: The proper addition of isopropanol during Section 6 of the Product Manual (Size Selection) is essential for the binding of the small RNA library cDNA to the NEBNext Sample Purification Beads. We recommend pre-wetting of pipette tips for the addition of isopropanol. Q: Can I do a gel size selection on the final libraries generated using the NEBNext Low-bias Small RNA Library Prep Kit (NEB #E3420)? A: The NEBNext Low-bias Small RNA Library Prep Kit has been optimized to remove the need for gel purification of the final library. However, if you prefer to isolate your library through gel size selection, you can clean up the PCR reaction by following instructions found in Section 8B of the Product Manual (Cleanup) and follow with a gel size selection on a 6% PAGE gel. Q: What is the required RIN for Total RNA to be used in NEBNext Low-bias Small RNA Library (NEB #E3420) generation? A: The NEBNext Low-bias Small RNA Library Prep Kit generates high quality small RNA libraries from high quality total RNA as well as degraded samples (such as FFPE). This kit has been tested on samples from RIN ~2.2 – 10. When working with low quality, highly degraded samples, the NEBNext Low-bias Small RNA Library Prep Kit will capture all small RNAs less then ~ 120 nt, regardless of their origin, that have 5' monophosphate and 3' OH ends. Q: Does the kit include primers? A: No. The kit can be used with the NEBNext LV Unique Dual Index Primers. For a complete list of low volume (LV) unique dual index primers, please see the third column of NEBNext® Multiplex Oligos Selection Chart. For use with NEBNext library prep kits, consult the library prep kit manual. The NEBNext LV Unique Dual Index Primers manuals also contain tips for setting up ligation reactions. For color balancing options, please see NEBNext® Index Oligo Selector for valid barcode combinations.