Product Description
For optimal workflow flexibility, NEBNext Related Categories NEBNext® Multiplex Oligos (Adaptors & Primers),, Next Generation Sequencing Library Preparation FAQ Q: Are NEBNext adaptors and primers for Illumina validated in Next Generation Sequencing Workflows? A: Yes, NEBNext adaptors and primers for Illumina are validated by creating genomic DNA libraries, Chip Libraries, as well as human mRNA libraries, followed by Illumina sequencing. Q: What is the concentration of the adaptor and primers in the NEBNext Multiplex Oligos kits? A: The adaptor is 15 μM and the primer mix is 10 μM (5 μM each). Q: Can I use the 96-well primer plate to do my PCR reactions when using the NEBNext® Multiplex Oligos for Illumina®? A: No, we do not recommend using the 96-well plate that the primers are packaged in. Although there is enough primer in each well for only one reaction, we provide excess primer to ensure sufficient amounts. This excess primer may result in primer-dimer formation during PCR. Q: How many reactions worth of primer are in each well? A: The primer plate was designed to be single-use. Although there is enough primer in each well for only one reaction, we provide excess primer to ensure sufficient amounts. We strongly recommend you do not use any leftover primer to avoid cross contamination with other indexed primers. Q: Is the NEBNext adaptor methylated? A: No, the NEBNext® Adaptor in NEB #E6440, #E6442, #E6444, #E6446, and #E6448 is not methylated, and therefore is not compatible with bisulfite sequencing protocols. A methylated version of the NEBNext Adaptor is supplied, along with index primers, in NEB #E7535. Q: Can I perform single read runs and still get both index sequences? Can I run both single read and paired-end recipes with dual-indexed libraries? A: Yes. Please select the appropriate workflow based on the flow cell type (Single Read or Paired End) when starting your run so that the correct chemistry is used. If using a single-read flow cell the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (catalog #FC-121-1003) is necessary in order to sequence both index reads. Adapted from Illumina website. Q: Are dual indexed libraries compatible with single end sequencing? A: Yes, the NEBNext Oligos for Illumina, including dual index oligos, are compatible with single read sequencing. Please refer to Illumina’s Indexed Sequencing Overview Guide (current version) for details on dual indexed sequencing workflows on a single-read flow cell or a paired-end flow cell. Q: How many indices are available with NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs) (NEB #E6440, E6442, E6444, E6446, and E6448)? A: Each kit comprises pairs of 96 unique i5 indices and 96 unique i7 indices. Each well of the primer plate contains a unique pair of one i5 index primer and one i7 index primer, thereby providing 96 unique dual indices. When used together, all five sets total 480 indices for multiplexing. Q: Can the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (NEB #E6440, #E6442, #E6444, #E6446, and #E6448) be used to address "index hopping" with Illumina patterned flow cells? A: Yes. The 96 Unique Dual Index Primer Pairs were designed to facilitate sequencing on patterned flow cells for the Illumina instruments where index hopping is problematic. The unique combination of 96 dual indices allows identification and complete filtering of index-swapped reads. Reference: https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4703-0 Q: Do you have Sample Sheets for use with the NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs Set 4)? A: Yes, a Sample Sheet with the index sequences for NovaSeq®, MiSeq®, HiSeq® 2000, and HiSeq 2500 can be found here, and a Sample Sheet with the index sequences for NextSeq®, MiniSeq®, HiSeq 3000, and HiSeq 4000 can be found here. Q: What should I do if the sample sheet from the NEB.com website is not compatible with the software version I am using? A: If the sample sheet is not correct for the software version you have, a sample sheet can be created with the Illumina Experiment Manager (IEM) and the index sequences from our sample sheet can be copied and pasted into yours. We would recommend contacting Illumina for any questions about how to use IEM. Q: Which sets of NEBNext Unique Dual Index Primer Pairs can be combined in a single Illumina sequencing run? A: NEB #E6440S/L, E6442S/L, E6444S/L, E6446S/L, and E6448S/L can all be combined. Q: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument? A: The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq: Adaptor Read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Adaptor Read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Q: What do I do if I received an index collision/barcode collision error? A: If you received an index collision error when demultiplexing the NEBNext Multiplex Oligos, upgrade to: Software Version Bclconvert 4.1.7 or later Bcl2fastq Any version Picard IlluminaBasecallsToSam Any version Reach out to Technical Support if you have more questions.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924