Iright
BRAND / VENDOR: New England Biolabs

New England Biolabs, E6609S, NEBNext® Multiplex Oligos for Illumina® (96 Index Primers)

CATALOG NUMBER: E6609S
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
NEBNext Related Categories Automation for NEBNext® NGS Library Prep,, RNA Library Prep for Illumina,, Next Generation Sequencing Library Preparation Applications Polymerases for NGS Library Preparation,, Applications of USER® and Thermolabile USER II Enzymes Specification Materials Required but not Supplied Enzymes and buffers appropriate for DNA, ChIP or mRNA Library Preparation (NEB #E7645, E7595, E7420, E7530, E7370, E7445, E6040, E6110, E6240, E6056, E6000, E6200, E6100) SPRIselect or AMPure® XP Beads (Beckman Coulter, Inc.) DNA LoBind® Tubes (Eppendorf®)/PCR Plates Magnetic Stand Bioanalyzer® (Agilent Technologies, Inc.) Freshly Prepared 80% Ethanol Please Refer to the Kit Specific Protocol for using the NEBNext Multiplex Oligos for Illumina: The following kits are designed for use with the NEBNext Multiplex Oligos for Illumina: #E7760, NEBNext Ultra II Directional RNA Library Prep Kit for Illumina #E7765, NEBNext Ultra II Directional RNA Library Prep with Sample Purification Beads #E7770, NEBNext Ultra II RNA library Prep Kit for Illumina #E7775, NEBNext Ultra II RNA Library Prep with Sample Purification Beads #E7805, NEBNext Ultra II FS DNA Library Prep Kit for Illumina #E6177, NEBNext Ultra II FS DNA Library Prep Kit with Sample Purification Beads #E7645, NEBNext Ultra II DNA Library Prep Kit for Illumina #E7103, NEBNext Ultra II DNA Library Prep with Sample Purification Beads #E7595, NEBNext Ultra II Ligation Module #E7420, NEBNext Ultra Directional RNA Library Prep Kit for Illumina #E7530, NEBNext Ultra RNA Library Prep Kit for Illumina #E7370, NEBNext Ultra DNA Library Prep Kit for Illumina #E7445, NEBNext Ultra Ligation Module #E6040, NEBNext DNA Library Prep Master Mix Set for Illumina #E6240, NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina #E6056, NEBNext Quick Ligation Module FAQ Q: Are NEBNext adaptors and primers for Illumina validated in Next Generation Sequencing Workflows? A: Yes, NEBNext adaptors and primers for Illumina are validated by creating genomic DNA libraries, Chip Libraries, as well as human mRNA libraries, followed by Illumina sequencing. Q: Are the NEBNext Oligos for Illumina compatible with single read and paired end sequencing? A: Yes, the NEBNext Oligos for Illumina, including dual index oligos, are compatible with both single read and paired end sequencing. Please refer to Illumina’s Indexed Sequencing Overview Guide (current version) for details on dual indexed sequencing workflows on a single-read flow cell or a paired-end flow cell. Q: What is the concentration of the adaptor and primers in the NEBNext Multiplex Oligos kits? A: The adaptor is 15 μM and the primer mix is 10 μM (5 μM each). Q: Can I use the 96-well primer plate to do my PCR reactions when using the NEBNext® Multiplex Oligos for Illumina®? A: No, we do not recommend using the 96-well plate that the primers are packaged in. Although there is enough primer in each well for only one reaction, we provide excess primer to ensure sufficient amounts. This excess primer may result in primer-dimer formation during PCR. Q: How many reactions worth of primer are in each well? A: The primer plate was designed to be single-use. Although there is enough primer in each well for only one reaction, we provide excess primer to ensure sufficient amounts. We strongly recommend you do not use any leftover primer to avoid cross contamination with other indexed primers. Q: Do you have a Sample Sheet with the index sequences that can be used in the Illumina Experiment Manager (IEM)? A: Yes, a Sample Sheet with the index sequences can be found here. Please refer to your specific Illumina Instrument User Guide for Instructions on use of the Sample Sheet. Q: Is the adaptor methylated? A: No, the adaptor in NEB #E6609 is not methylated, and therefore is not compatible with bisulfite sequencing. For methylated adaptor and indexed primers, please refer to NEB #E7535. Q: Is the USER enzyme in our NEBNext kits identical in concentration to the standalone product? A: Yes, the concentration of USER in our Oligo kits is 1,000 U/ml which is also sold separately as NEB #M5505 . Q: Is USER enzyme required for library preparation using NEBNext adaptor and primers for Illumina? A: Yes. The NEBNext adaptor for Illumina contains a specially modified nucleotide that needs to be cleaved by USER before PCR amplification. Q: Can USER Enzyme be purchased separately? A: USER Enzyme is available as NEB catalog #M5505 and can be used in the NEBNext Oligos protocols. Q: Are these reagents available in a customized format, larger format or 96 well formats? A: Yes, customized formats can be accommodated. Please contact our OEM department at custom@neb.com for more details. Q: How do I use the NEB provided Sample Sheet for my specific instrument? A: When using LRM, use the provided .tsv file on the product page "Usage Guidelines" section. If not using LRM: Download sample sheet from the product page for the index kit you are using from the NEB.com website. Sample sheets can be found on the Protocols, Manuals and Usage/ Usage Guidelines section or FAQs and Troubleshooting/ Do you have a sample sheet. For dual indexed libraries, ensure the correct version of the sample sheet is downloaded per https://knowledge.illumina.com/software/general/software-general-reference_material-list/000001800, Illumina Knowledge Base Article 1800. Use Illumina Experiment Manager to create a sample sheet for your specific instrument and sequencing run settings. Make a sample sheet with a single row and open it in excel. Copy and paste the index sequences from the NEB sample sheet into this excel file. Make sure columns line up with column headers. Please contact Illumina Technical Support for any additional questions about using IEM or sample sheet formatting. Q: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument? A: The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq: Adaptor Read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Adaptor Read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Q: Are NEBNext adaptor and primers for Illumina compatible with NEBNext reagents for Illumina library preparation? A: Yes, NEBNext Multiplex Oligos (Adaptors and Primers) for Illumina are compatible with NEBNext kits for DNA, RNA, and ChIP-seq library preparation. Refer to the NEBNext Multiplex Oligos Selection Chart (www.neb.com/oligos) for the full range of options available. Note: Multiplexing (indexing) oligos are not included in most NEBNext library prep kits, and must be ordered separately. Adaptors and primers are included in the NEBNext Enzymatic Methyl-seq Kit and the NEBNext Small RNA Library Prep Kits, as they are optimized for specific input types and sample amounts.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924