Iright
BRAND / VENDOR: New England Biolabs

New England Biolabs, E7416S, NEBNext® Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1)

CATALOG NUMBER: E7416S
Regular price$0.99
/
Shipping calculated at checkout.
  • ddddd

    99 xxxxxx

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
NEBNext Related Categories NEBNext® Multiplex Oligos (Adaptors & Primers),, Next Generation Sequencing Library Preparation FAQ Q: What are the advantages of UMI adaptors? A: To better represent true transcript abundance levels, Unique Molecular Identifiers (UMIs) can be used to distinguish PCR duplicates from reads that originate from distinct original molecules. Accurate identification of such artifacts can significantly impact quantification of transcript abundance, and subsequently affect differential expression analyses, especially for low-abundance genes. Q: What library prep kits are the NEBNext® Unique Dual Index UMI Adaptors for RNA compatible with? A: The NEBNext® Unique Dual Index UMI Adaptors for RNA are compatible with the NEBNext® Ultra II RNA Library Prep Kits (NEB #E7760, #E7770) with poly(A) mRNA enrichment (NEB #E7490) or rRNA depletion (NEB #E7400, NEB #E7490, #E6350, NEB #E7750, NEB #E7850). Q: How can I reduce adaptor dimer? A: During the ligation step, the Ligation Master Mix and Ligation Enhancer can be mixed prior to setting up the reaction but ensure that the adaptor is not added to the master mix prior to setting up the reaction. Keep all reagents and buffers on ice unless otherwise noted and ensure the ligation reaction is set up on ice. It is more common to see adaptor dimers at low inputs. If adaptor dimer is present, bring volume of libraries to 50 μl with 0.1x TE buffer and repeat the SPRIselect Bead or NEBNext Sample Purification Bead cleanup steps. Alternatively, especially for precious and low input material, samples can be pooled and second cleanup performed with 0.9X volume of beads prior to loading the sequencing instrument. Q: Do you have Sample Sheets for use with the NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index UMI Adaptors RNA Set 1)? A: Yes, Sample Sheets with the index sequences for NovaSeq®, MiSeq®, HiSeq® 2000, and HiSeq 2500 are available with and without inclusion of the UMI sequence. Sample Sheets with the index sequences for NextSeq®, MiniSeq®, HiSeq 3000, and HiSeq 4000 are available with and without inclusion of the UMI sequence. Q: Are NEBNext® Unique Dual Index UMI Adaptors for RNA validated in Next Generation Sequencing Workflows? A: Yes, NEBNext Unique Dual Index UMI Adaptors for Illumina are validated by creating RNAseq libraries, followed by Illumina sequencing. Q: Are the NEBNext® Unique Dual Index UMI Adaptors for RNA compatible with single-read and paired-end sequencing? A: Yes, the NEBNext® Unique Dual index RNA UMI Adaptors for Illumina are compatible with both single-read and paired-end sequencing. Q: What are the concentrations of the adaptor and primers in the kit? A: The concentration of unique dual index UMI adaptor found in NEBNext® Unique Dual Index UMI Adaptors RNA Set 1 is 1 μM and the PCR primer mix concentration is 40 μM. Q: How many reactions worth of adaptor is in each well? A: Sufficient amount of adaptor is provided for at least one reaction at the highest input of 1 μg RNA. Q: Is the NEBNext adaptor methylated? A: No, the NEBNext® Adaptor in NEB #E6440, #E6442, #E6444, #E6446, and #E6448 is not methylated, and therefore is not compatible with bisulfite sequencing protocols. A methylated version of the NEBNext Adaptor is supplied, along with index primers, in NEB #E7535. Q: How many indices are available with NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index UMI Adaptors RNA Set 1) NEB #7416? A: Each module comprises 96 unique dual indices. The E7416S plate contains 96 unique i5 indices and 96 unique i7 indices in combination. This combination of unique i5 and i7 indices minimizes index hopping. The E7416L kit contains four plates with the same 96 unique combinations of i5 and i7 indices. Q: Is the NEBNext® Unique Dual Index UMI Adaptor for RNA compatible with other manufacturer’s library preparation kits? A: Yes, the NEBNext ® Unique Dual Index UMI Adaptor is compatible with library preparation methods besides the NEBNext® products. Follow manufacturer’s protocols, substituting NEBNext UMI adaptors at concentrations specified by manufacturer. Q: Are dual indexed libraries compatible with single end sequencing? A: Yes, the NEBNext Oligos for Illumina, including dual index oligos, are compatible with single read sequencing. Please refer to Illumina’s Indexed Sequencing Overview Guide (current version) for details on dual indexed sequencing workflows on a single-read flow cell or a paired-end flow cell. Q: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument? A: The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq: Adaptor Read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Adaptor Read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Q: What do I do if I received an index collision/barcode collision error? A: If you received an index collision error when demultiplexing the NEBNext Multiplex Oligos, upgrade to: Software Version Bclconvert 4.1.7 or later Bcl2fastq Any version Picard IlluminaBasecallsToSam Any version Reach out to Technical Support if you have more questions.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924