Product Description
NEBNext Multiplex Oligos provide adaptors and primers to enable high yield multiplex Illumina library production. The unique hairpin loop structure of the NEBNext Adaptor minimizes adaptor-dimer formation, and NEBNext index PCR primers enable index incorporation during library amplification. This kit includes 8 i5 index primers and 12 i7 index primers for dual indexing. Related Categories NEBNext® Multiplex Oligos (Adaptors & Primers) Applications Applications of USER® and Thermolabile USER II Enzymes Specification Materials Required but not Supplied For the list of additional materials required, please check the manual for your NEBNext Library Prep Kit. FAQ Q: Where can I find the sample sheets for these Multiplex Oligos? A: Instrument-specific sample sheets can be downloaded from the Usage Guidelines section located under the “Protocols, Manual & Usage” tab. If you are sequencing on a NovaSeq® 6000 with v1.0 reagent kits, MiniSeq® with Rapid reagent kits, MiSeq®, HiSeq® 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell), please choose the sample sheet labeled “Forward Strand Workflow Sample Sheet”. * If you are sequencing on a iSeq 100, MiniSeq® with Standard reagent kits, NextSeq® Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell), please choose the sample sheet labeled “Reverse Complement Workflow Sample Sheet”. * * Our samples sheets are based on the current Illumina Sequencing Overview Guide. Please choose the correct sample sheet, based on your Illumina instrument and reagent kits. For more information on Illumina indexing please refer to the most current version of the Illumina Sequencing Overview Guide. Q: Do NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1)come with library prep reagents? A: No. NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1)contain adaptors, PCR primers, and USER enzyme only. Library preparation kits are sold separately. The following is a list of compatible library preparation kits: NEBNext Ultra DNA Library Prep Kit for Illumina (#E7370) NEBNext DNA Library Prep Master Mix Set for Illumina (#E6040) NEBNext DNA Library Prep Reagent Set for Illumina (#E6000) NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240) NEBNext ChIP-seq Library Prep Reagent Set for Illumina (#E6200) NEBNext Ultra Directional RNA Library Prep Kit for Illumina (#E7420) NEBNext Ultra RNA Library Prep Kit for Illumina (#E7530) NEBNext mRNA Library Prep Master Mix Set for Illumina (#E6110) NEBNext mRNA Library Prep Reagent Set for Illumina (#E6100) Q: Can I use NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) for library prep from both DNA and RNA samples? A: Yes. NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1)are compatible with both DNA and RNA library preparation. Please refer to chapters 1-5 in the manual for DNA or ChIP library preparation protocols or chapters 6-9 for RNA library preparation protocols. Q: How many libraries can I prepare with the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1)? A: Up to 96 libraries can be prepared with each NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1). Q: For pooling <96 samples, what combination of indices should I use? A: Please refer to Appendix A in Chapter 10 of the manual (page 115) for a detailed guideline for low level indexing. Q: Can I perform single read runs and still get both index sequences? Can I run both single read and paired-end recipes with dual-indexed libraries? A: Yes. Please select the appropriate workflow based on the flow cell type (Single Read or Paired End) when starting your run so that the correct chemistry is used. If using a single-read flow cell the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (catalog #FC-121-1003) is necessary in order to sequence both index reads. Adapted from Illumina website. Q: Are dual indexed libraries compatible with single end sequencing? A: Yes, the NEBNext Oligos for Illumina, including dual index oligos, are compatible with single read sequencing. Please refer to Illumina’s Indexed Sequencing Overview Guide (current version) for details on dual indexed sequencing workflows on a single-read flow cell or a paired-end flow cell. Q: Is the USER enzyme in our NEBNext kits identical in concentration to the standalone product? A: Yes, the concentration of USER in our Oligo kits is 1,000 U/ml which is also sold separately as NEB #M5505 . Q: How do I use the NEB provided Sample Sheet for my specific instrument? A: When using LRM, use the provided .tsv file on the product page "Usage Guidelines" section. If not using LRM: Download sample sheet from the product page for the index kit you are using from the NEB.com website. Sample sheets can be found on the Protocols, Manuals and Usage/ Usage Guidelines section or FAQs and Troubleshooting/ Do you have a sample sheet. For dual indexed libraries, ensure the correct version of the sample sheet is downloaded per https://knowledge.illumina.com/software/general/software-general-reference_material-list/000001800, Illumina Knowledge Base Article 1800. Use Illumina Experiment Manager to create a sample sheet for your specific instrument and sequencing run settings. Make a sample sheet with a single row and open it in excel. Copy and paste the index sequences from the NEB sample sheet into this excel file. Make sure columns line up with column headers. Please contact Illumina Technical Support for any additional questions about using IEM or sample sheet formatting. Q: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument? A: The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq: Adaptor Read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Adaptor Read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924