New England Biolabs, E7658L, NEBNext® ARTIC SARS-CoV-2 FS Library Prep Kit (Illumina®)

The Small size of this product was discontinued on December 15, 2024. The Large size (NEB #E7658L) will continue to be available. Related Categories NEBNext® ARTIC products for SARS-CoV-2 sequencing Specification Materials Required but not Supplied NEBNext Singleplex or Multiplex Oligos for Illumina –www.neb.com/oligos 80% Ethanol (freshly prepared) Nuclease-free Water DNA LoBind Tubes (Eppendorf®#022431021) Magnetic rack/stand (NEB #S1515, Alpaqua®, cat. #A001322 or equivalent) Thermocycler Vortex Mixer Microcentrifuge Agilent®Bioanalyzer®or similar fragment analyzer and associated consumables DNase RNase free PCR strip tubes (USA Scientific®1402-1708) FAQ Q: What is the difference between the NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes and the original NEBNext VarSkip Short SARS-CoV-2 Primer Mixes? A: The NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes have been optimized to improve coverage of the Omicron variant. In these v2 mixes, 10 primers have been replaced, affecting 7 primer pairs. Q: What is the difference between the NEBNext VarSkip v2 Short SARS-CoV-2 Primer Mixes and the NEBNext ARTIC SARS-CoV-2 Primer Mixes? A: VarSkip Short v2 SARS-CoV-2 Mixes 1 and 2 for SARS-CoV-2 genome amplification are based on hCoV-2019/nCoV-2019 Version 3 (v3) sequences with balanced primer concentrations. NEBNext VarSkip Short v2 SARS-CoV-2 Mixes 1 and 2 for SARS-CoV-2 genome amplification were designed to reduce the impact of variants on amplification efficiency. NEBNext ARTIC SARS-CoV-2 amplicons are ~400 bp, whereas NEBNext VarSkip Short v2 SARS-CoV-2 amplicons are ~550 bp. Q: Where can I find primer sequence information for NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes and NEBNext ARTIC SARS-CoV-2 Primer Mixes? A: NEBNext VarSkip Short v2 SARS-CoV-2 Primer sequences can be found here: https://github.com/nebiolabs/VarSkip NEBNext ARTIC SARS-CoV-2 Primer sequences can be found here: https://github.com/joshquick/artic-ncov2019/blob/master/primer_schemes/nCoV-2019/V3/nCoV-2019.tsv Q: Can the NEBNext ARTIC SARS-CoV-2 Primer Mixes and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes be added to the same targeted amplification reaction? A: No, the NEBNext ARTIC SARS-CoV-2 Primer Mixes and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes cannot be added to the same amplification reaction. Q: Which primer scheme should I use: NEBNext ARTIC SARS-CoV-2 Primer Mixes or NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes? A: NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes are recommended for known or expected SARS-CoV-2 variant samples. Q: Can the NEBNext VarSkip Short v2 SARS-CoV-2 Primers cover non-variant SARS-CoV-2 samples? A: Yes, they can also be used to amplify non-variant SARS-CoV-2 samples. Q: Which SARS-CoV-2 variants can the NEBNext VarSkip Short v2 SARS-CoV-2 Primers cover? A: The VarSkip Short SARS-CoV-2 Short primers were designed to be variant tolerant. We have confirmed that these primers provide high genome coverage for the following variants: B.1.351 (Beta) P.1. (Gamma) B1.617.1 (Kappa) B.1.617.2 (Delta) B.1.617.3 BA.1 (Omicron) BA.2 (Omicron) Q: Can the NEBNext ARTIC Human Control Primer Pairs and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes be added to the same targeted amplification reaction? A: Yes, the NEBNext ARTIC Human Control Primer Pairs 1 and 2 are optional internal controls. If used, the appropriate NEBNext ARTIC Human Control Primer Pairs and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mix should be combined prior to use. Human Control Primer Pairs 1 can be combined with NEBNext ARTIC NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mix 1 and Human Control Primer Pairs 2 can be combined with NEBNext ARTIC NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mix 2. NEBNext ARTIC Human Control Primer Pairs generate 400 bp amplicons, while VarSkip Short v2 amplicons are ~550bp. After enzymatic fragmentation Human Control and VarSkip Short v2 SARS-CoV-2 fragment sizes are both ~120 bp. Q: How do I analyze VarSkip Short v2 SARS-CoV-2 sequencing data? A: VarSkip Short v2 SARS-CoV-2 sequencing data can be analyzed using the same analysis methods as ARTIC multiplex amplicon sequencing. All necessary reference files for modifying ARTIC sequencing analysis pipelines for VarSkip Short v2 SARS-CoV-2 sequencing analysis can be found at https://github.com/nebiolabs/VarSkip. Q: Are the sequences of the primers in the NEBNext ARTIC SARS-CoV-2 Primer Mixes the same as the ARTIC Network V3 primers? A: Yes, the sequences are the same, and can be found here. The primers in the NEBNext ARTIC SARS-CoV-2 Primer Mixes have been balanced, using methodology developed at NEB based on empirical data from sequencing, in order to product more uniform coverage across the genome. Q: What read length is recommended for sequencing of libraries generated using the  NEBNext ARTIC SARS-CoV-2 FS Kit (Illumina)? A: Libraries generated with this kit are 200-270 bp, including Illumina-specific sequences. A 2 X 75 bp paired end sequencing run is recommended to cover the length of the insert. Q: How many sequencing reads do I need for sequencing of libraries generated using the  NEBNext ARTIC Kits for Illumina? A: The number of reads required depends on the quality and quantity of the starting material. We recommend starting with 0.5 million reads to ensure adequate coverage. Following analysis, the read number on subsequent sequencing runs can be adjusted for your samples. Q: What Ct values are recommended for inputs used with the NEBNext ARTIC kits for Illumina? A: Use of samples with Ct values less than 32 is recommended. Q: How do I analyze data from libraries generated using the NEBNext ARTIC kits for Illumina? A: The sequence data produced is compatible with a number of analysis tools including https://nf-co.re/viralrecon and https://covid19.galaxyproject.org/artic/. To maximize variant calling effectiveness in this overlapping amplicon approach, it is recommended to mask primer regions on read pairs (not the reference). It is important to consider both mates when deciding which bases to consider in variant assessment. Regions of low coverage may be due to the presence of variant bases in a priming region. Adjacent amplicons can be used to differentiate between such variant-mediated events from stochastic coverage variation. Q: Which NEBNext adaptors and primers are recommended for use with the ARTIC kits for Illumina? A: Instrument NextSeq 1000/2000, NovaSeq, any instrument with barcode hopping issues Recommendation Any of the four NEBNext Multiplex Oligos for Illumina (Unique Dual Index Primer Pairs) Sets 1-4: E6440, E6442, E6444, E6446. <96 samples Purchase the S size ≥96 samples Recommendation depends on how many samples user plans on pooling for each sequencing run: If pooling > 96 samples for a single run, users would need multiple UDI Sets. This is more likely with high throughput instruments e.g. NovaSeq. If ≥96 samples will not be pooled together for a single run, recommend L size of one kit. Instrument MiSeq and NextSeq 500/550 Recommendation Any NEBNext Oligos product can be used. If there is any chance that the libraries will be sequenced on NextSeq or NovaSeq, Unique Dual Index sets are recommended. <96 samples If only MiSeqs are available and <96 samples are pooled, the plated 96 single-index primer set (E6609) is the most user-friendly. ≥96 samples All NEBNext Oligos can be used, and users should decide on their preferred product format. Instrument MiniSeq Recommendation Any NEBNext Oligos product can be used. If there is any chance that the libraries will be sequenced on NextSeq or NovaSeq, Unique Dual Index sets are recommended. <96 samples If only MiniSeqs are available and <96 samples are pooled, the plated 96 single-index primer set (E6609) is the most user-friendly. ≥96 samples All NEBNext Oligos can be used, and users should decide on their preferred product format. Q: Do I need to add PhiX to the sequencing run? A: Libraries generated with this method are sufficiently complex such that PhiX is not necessary to increase complexity. However, it is recommended to add PhiX at > 1% as a quality control for the sequencing run. Q: Do I need to normalize library concentration prior to sequencing? A: To optimize the number of sequence reads obtained for each library, normalization prior to sequencing is recommended. However, for this method normalization may not be necessary. We have received feedback from users who have obtained good results without normalization. Q: What should the final loading concentration be for MiSeq® and NextSeq® 500/550 Illumina® sequencing platforms? A: The final loading concentration depends on the Illumina instrument and sequencing reagents. For MiSeq sequencing with V2 or V3 reagents, we recommend 8-10 pM. For NextSeq 500/550, we recommend 1.2-1.4 pM. Q: Does my total RNA sample need to be DNA-free prior to starting the ARTIC workflow? A: No, the RNA does not need to be DNA-free for the ARTIC workflow. Q: Can coverage be improved for the recent variants? A: Yes, spike-in primers have been designed and tested to address low coverage areas caused by KP and JN variants. These primers can be provided free of charge upon request. Please contact info@neb.com. Alternatively, the sequences below can be used for custom primer synthesis from your preferred oligo provider. These spike-in primers should be used with the VarSkip Short v2 primers following the protocols below. VSSv2f Spike-in Mix Primer Sequence Target Concentration in 1xPool (µM) 1 varskip-0317-1_1_LEFT_ALT3 ATCTCTTGTAGATCTGTTCTCTAAACG 0.5 1 varskip-0317-1_05_RIGHT_ALT2 GACAATTTCACAAGCACAGGTTGAG 0.5 1 varskip-0317-1_07_LEFT_ALT2 CCTCTAAAAGCCCCAAAAGAAATTATC 0.5 1 varskip-0317-1_09_RIGHT_ALT2 GTTTACTTTCAGTTATAAATGGCTTAACTTC 0.5 1 varskip-0317-1_11_LEFT_ALT2 GTGGCACTACTGAAATGCTAGC 0.5 1 varskip-0317-1_13_RIGHT_ALT2 TTCATAAGAAAGTGTGCCCATGTAC 0.5 1 varskip-0317-1_15_RIGHT_ALT1 GCTCCAAAGACAACGTATACACC 0.5 1 varskip-0317-1_35_LEFT_ALT2 GATGATTATTTCAATAAAAAGGACTGGTATG 0.5 1 varskip-0317-1_45_RIGHT_ALT2 ATTGATCTCCAGGCGGTGGTTT 0.5 1 49_R_ALT2 GTAATAAGAACACCATTACGGGCAT 0.5 1 varskip-0317-1_53_RIGHT_ALT2 TGAGGATCTGAAAACTTTGTCAGG 0.5 1 55_L_ALT1 CCTACTTATTGTTAATAACGCTACTAATGTT 0.5 1 varskip-0317-1_57_LEFT_ALT6 CTCTGCTTTACTAATGTCTATGCAGA 0.5 2 varskip-0317-1_24_LEFT_ALT2 GCCTTTAATACTTTACTATTCCTTATGTC 0.5 2 varskip-0317-1_28_RIGHT_ALT2 AGGCCAAAGTAACAAGTACAAAAATAGC 0.5 2 varskip-0317-1_32_RIGHT_ALT2 CTGTTATTGCCTGACCAGTACC 0.5 2 varskip-0317-1_34_RIGHT_ALT2 ATCACAGAATTGTACTGTTTTTAACAAAGC 0.5 2 varskip-0317-1_54_RIGHT_ALT2 CTTCAAGGTCCATAAGAAAAGGCT 0.5 2 56L_ALT1 TTATTATGTGGGTTATCTTCAACCTAGG 0.5 2 varskip-0317-1_56_RIGHT_ALT2 CAGCCTGTAAAATCATCTGGTAATTTAT 0.5 Protocols for use of spike-in primers: For 96-reaction kits: Thaw VSSv2f Spike-in Mix 1, VSSv2f Spike-in Mix 2, VSSv2 Primer Mix 1. and VSSv2 Primer Mix 2. Mix and quick spin all four tubes. Add 3 μl of VSSv2f Spike-in Mix 1 to VSSv2 Primer Mix 1, vortex, spin-down, place on ice. Add 2.5 μl of VSSv2f Spike-in Mix 2 to VSSv2 Primer Mix 2, vortex, spin-down, place on ice. Use spiked VarSkip Short v2 Primer Mix 1 and 2 for RT-PCR protocol. For 24-reaction kits: Thaw VSSv2f Spike-in Mix 1, VSSv2f Spike-in Mix 2, VSSv2 Primer Mix 1. and VSSv2 Primer Mix 2. Mix and quick spin all four tubes. Add 2 μl of VSSv2f Spike-in Mix 1 to 2 μl 0.1x TE to make a ½ dilution of the VSSv2f Spike-in Mix 1. Add 1.5 μl of diluted VSSv2f Spike-in Mix 1 to VSSv2 Primer Mix 1, vortex, spin-down, place on ice. Add 2 μl of VSSv2f Spike-in Mix 2 to 2 μl 0.1x TE to make a ½ dilution of the VSSv2f Spike-in Mix 2. Add 1.25 μl of diluted VSSv2f Spike-in Mix 2 to VSSv2 Primer Mix 2, vortex, spin-down, place on ice. Use spiked VarSkip Short v2 Primer Mix 1 and 2 for RT-PCR protocol. Q: Can I still make ARTIC-SARS-CoV-2 Libraries for Illumina without enzymatic fragmentation? A: Yes. You will need the following kits to recapitulate our discontinued product E7650. E7626 NEBNext® ARTIC SARS-CoV-2 RT-PCR Module E7645 NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® E6440 NEBNext® Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Follow the E7650 manual just replacing the NEBNext Library PCR Master Mix with NEBNext Ultra II Q5 Master Mix.