Iright
BRAND / VENDOR: New England Biolabs

New England Biolabs, E7660L, NEBNext® ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies®)

CATALOG NUMBER: E7660L
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
The Small size of this product was discontinued on December 15, 2024. The Large size (NEB #E7660L) will continue to be available. Related Categories Library Preparation for Oxford Nanopore Technologies,, NEBNext® ARTIC products for SARS-CoV-2 sequencing,, RNA Library Prep for Illumina, Specification Materials Required but not Supplied 80% Ethanol (freshly prepared) DNA LoBind Tubes (Eppendorf #022431021) Oxford Nanopore Technologies Native Barcoding Expansion kits 1-12 (EXP-NBD104), 13-24 (EXP-NBD114) or 1-96 (EXP-NBD196) Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK109) Oxford Nanopore Technologies SFB Expansion Kit (EXP-SFB001) Qubit® dsDNA HS Assay Kit (ThermoFisher® Q32851) Magnetic rack/stand (NEB #S1515, Alpaqua®, cat. #A001322 or equivalent) Thermal cycler Vortex Mixer Microcentrifuge Agilent® Bioanalyzer® or similar fragment analyzer and associated consumables (4150 or 4200 TapeStation System) DNase RNase free PCR strip tubes (USA Scientific 1402-1708) 1.5 ml tube magnet stand (NEB #S1506) FAQ Q: What is the difference between the NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes and the original NEBNext VarSkip Short SARS-CoV-2 Primer Mixes? A: The NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes have been optimized to improve coverage of the Omicron variant. In these v2 mixes, 10 primers have been replaced, affecting 7 primer pairs. Q: What is the difference between the NEBNext VarSkip v2 Short SARS-CoV-2 Primer Mixes and the NEBNext ARTIC SARS-CoV-2 Primer Mixes? A: VarSkip Short v2 SARS-CoV-2 Mixes 1 and 2 for SARS-CoV-2 genome amplification are based on hCoV-2019/nCoV-2019 Version 3 (v3) sequences with balanced primer concentrations. NEBNext VarSkip Short v2 SARS-CoV-2 Mixes 1 and 2 for SARS-CoV-2 genome amplification were designed to reduce the impact of variants on amplification efficiency. NEBNext ARTIC SARS-CoV-2 amplicons are ~400 bp, whereas NEBNext VarSkip Short v2 SARS-CoV-2 amplicons are ~550 bp. Q: Where can I find primer sequence information for NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes and NEBNext ARTIC SARS-CoV-2 Primer Mixes? A: NEBNext VarSkip Short v2 SARS-CoV-2 Primer sequences can be found here: https://github.com/nebiolabs/VarSkip NEBNext ARTIC SARS-CoV-2 Primer sequences can be found here: https://github.com/joshquick/artic-ncov2019/blob/master/primer_schemes/nCoV-2019/V3/nCoV-2019.tsv Q: Can the NEBNext ARTIC SARS-CoV-2 Primer Mixes and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes be added to the same targeted amplification reaction? A: No, the NEBNext ARTIC SARS-CoV-2 Primer Mixes and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes cannot be added to the same amplification reaction. Q: Which primer scheme should I use: NEBNext ARTIC SARS-CoV-2 Primer Mixes or NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes? A: NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes are recommended for known or expected SARS-CoV-2 variant samples. Q: Can the NEBNext VarSkip Short v2 SARS-CoV-2 Primers cover non-variant SARS-CoV-2 samples? A: Yes, they can also be used to amplify non-variant SARS-CoV-2 samples. Q: Which SARS-CoV-2 variants can the NEBNext VarSkip Short v2 SARS-CoV-2 Primers cover? A: The VarSkip Short SARS-CoV-2 Short primers were designed to be variant tolerant. We have confirmed that these primers provide high genome coverage for the following variants: B.1.351 (Beta) P.1. (Gamma) B1.617.1 (Kappa) B.1.617.2 (Delta) B.1.617.3 BA.1 (Omicron) BA.2 (Omicron) Q: Can the NEBNext ARTIC Human Control Primer Pairs and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mixes be added to the same targeted amplification reaction? A: Yes, the NEBNext ARTIC Human Control Primer Pairs 1 and 2 are optional internal controls. If used, the appropriate NEBNext ARTIC Human Control Primer Pairs and NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mix should be combined prior to use. Human Control Primer Pairs 1 can be combined with NEBNext ARTIC NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mix 1 and Human Control Primer Pairs 2 can be combined with NEBNext ARTIC NEBNext VarSkip Short v2 SARS-CoV-2 Primer Mix 2. NEBNext ARTIC Human Control Primer Pairs generate 400 bp amplicons, while VarSkip Short v2 amplicons are ~550bp. After enzymatic fragmentation Human Control and VarSkip Short v2 SARS-CoV-2 fragment sizes are both ~120 bp. Q: How do I analyze VarSkip Short v2 SARS-CoV-2 sequencing data? A: VarSkip Short v2 SARS-CoV-2 sequencing data can be analyzed using the same analysis methods as ARTIC multiplex amplicon sequencing. All necessary reference files for modifying ARTIC sequencing analysis pipelines for VarSkip Short v2 SARS-CoV-2 sequencing analysis can be found at https://github.com/nebiolabs/VarSkip. Q: Are the sequences of the primers in the NEBNext ARTIC SARS-CoV-2 Primer Mixes the same as the ARTIC Network V3 primers? A: Yes, the sequences are the same, and can be found here. The primers in the NEBNext ARTIC SARS-CoV-2 Primer Mixes have been balanced, using methodology developed at NEB based on empirical data from sequencing, in order to product more uniform coverage across the genome. Q: What Ct values are recommended for inputs used with the NEBNext ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies)? A: Consistent with guidelines from the ARTIC Network, viral RNA input from clinical samples should be between Ct 18-35. If Ct is between 12-15, it is recommended to dilute the sample 100-fold in water. If the Ct is between 15-18 a 10-fold dilution in water is recommended. This will reduce the likelihood of PCR inhibition. Q: If I am using 96 samples, can I skip the cleanup step after the Targeted cDNA Amplification? A: For large numbers of samples, the cleanup step after Targeted cDNA Amplification (section 2.5 in the manual) can be skipped and cDNA samples can be used directly for NEBNext End Prep (section 4.1). This is consistent with the ARTIC Network nCoV-2019 sequencing protocol v3 (LoCost) protocol. Q: How much data do I need when sequencing libraries generated using the NEBNext ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies)? A: In testing using samples of synthetic or heat inactivated SARS-CoV-2 RNA with Ct 30 or approximately 1,000 copies of gRNA, complete genome assembly (>90% for synthetic and >99% for heat inactivated covid19 RNA) was achieved using 250x coverage data or 24,500 reads. Q: How do I analyze my data from sequencing libraries generated using the NEBNext ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies)? A: It is recommended to use ARTIC-nCoV-bioinformaticsSOP-v1.1. from ARTIC Network. RAMPART workflow also can be used for real time read assignment, mapping, and phylogenetic analysis. Q: Which kits from Oxford Nanopore Technologies do I need for the complete workflow? A: You will need the following kits: Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK109) or Oxford Nanopore Technologies Adapter Mix II Expansion (EXP-AMII001), Flow Cell Priming kit (EXP-FLP002) and Sequencing Auxiliary Vials (EXP-AUX001) Oxford Nanopore Technologies SFB Expansion Kit (EXP-SFB001) Oxford Nanopore Technologies Native Barcoding Expansion Kits 1-12 (EXP-NBD104), 13-24 (EXP-NBD114) or 1-96 (EXP-NBD196) Q: Is the NEBNext ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies) compatible with the ARTIC Network nCoV-2019 sequencing protocol v3 (LoCost) or the Oxford Nanopore Technologies Eco PCR Tiling protocol? A: This kit is broadly compatible with these protocols. However, it is essential to follow the NEBNext ARTIC RT-PCR protocol in order to achieve optimal amplicon amplification with the balanced primer set. Note that purchase of additional Q5 Hot Start High-Fidelity 2x Master Mix (NEB #M0494) will be required if these protocols are followed. Q: Are there tips to avoid barcode cross contamination? A: To avoid barcode cross contamination or mismatch during base calling, it is recommended to run guppy again to sort reads with both 5′ and 3′ ligated with the same barcodes. Oxford Nanopore Technologies provides additional information on use of guppy with the option of basecall reads with dual barcodes. Q: Is the NEBNext ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies) compatible with all ONT instruments? A: Libraries generated using this kit can be run on any Oxford Nanopore Technologies platform. MinION and GridION are recommended for this application. Q: Does the NEBNext ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies) kit include sufficient beads for the entire ARTIC library prep workflow? A: E7660 includes sufficient beads for the entire workflow, including the parts of the workflow that use kits from Oxford Nanopore Technologies. The only required reagent that is not provided in the kit is 80% ethanol. Q: Are there steps I can take if the pore occupancy number is low when performing sequencing? A: The following approaches can be helpful: To ensure good pore occupancy, 20ng of library DNA should be loaded for sequencing on MinION and GridION. Some carryover contaminants from extracted RNA samples or library prep reagents can negatively impact pore occupancy. To solve this issue, a 2x 1 ml 80% ethanol wash can be performed at step 1.6.19 instead of 1x 500 µl of 80% ethanol. Also, a cleaner library DNA can be prepared by performing an additional 250 µl SFB wash at step 1.8.8, for a total of 3x 250 µl SFB washes. Q: Can I use less of the native barcode adaptor during the ligation step (1.5.1)? A: If you plan to run a large number of samples, e.g. a total of 48 samples per sequencing run, you can reduce the reaction volume at step 1.5.1 by half, and also reduce the volume of every component in that reaction by half. However, if you are running 24 samples or less, we recommend following our standard protocol. Q: How can the percentage of dual-barcoded reads be increased A: Dual-barcoded reads are reads with the sequencing adaptor at both ends. To increase the dual-barcoded reads percentage, the RT-PCR amplicon products can be diluted 3-fold, and 1 µl of the diluted amplicons used in NEBNext End Prep step 1.4.1. This will reduce the amount of DNA input and the final data throughput for each sample, but will provide improved End Prep efficiency and result in a higher percentage of dual-barcoded reads. We recommend performing this amplicon dilution when 48 or more samples are used. Q: What if I don’t have enough samples to be able to generate enough library DNA for sequencing? A: Two or more barcoding reactions (step 1.4.1) can be performed per amplicon sample. We recommend use of the same barcode if the reactions are from the same sample, for easier downstream data analysis. Q: For high Ct samples, how can the data throughput be increased? A: For samples of Ct value 30 or higher, sequencing failures may increase. For such high Ct samples, two or more barcoding reactions (step 1.4.1) can be performed for each PCR amplicon, to increase the data throughput. We recommend use of the same barcode if the reactions are from the same sample, for easier downstream data analysis. Q: Does my total RNA sample need to be DNA-free prior to starting the ARTIC workflow? A: No, the RNA does not need to be DNA-free for the ARTIC workflow. Q: Is the NEBNext® ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies®) E7660 compatible with Oxford Nanopore Native Barcoding Kit V14 (SQK-NBD114)? A: Yes, it is compatible. We recommend following the NEBNext ARTIC SARS-CoV-2 Companion Kit (Oxford Nanopore Technologies) E7660 protocol as before and not the SQK-NBD114 protocol, including for the loading concentration. Q: Can coverage be improved for the recent variants? A: Yes, spike-in primers have been designed and tested to address low coverage areas caused by KP and JN variants. These primers can be provided free of charge upon request. Please contact info@neb.com. Alternatively, the sequences below can be used for custom primer synthesis from your preferred oligo provider. These spike-in primers should be used with the VarSkip Short v2 primers following the protocols below. VSSv2f Spike-in Mix Primer Sequence Target Concentration in 1xPool (µM) 1 varskip-0317-1_1_LEFT_ALT3 ATCTCTTGTAGATCTGTTCTCTAAACG 0.5 1 varskip-0317-1_05_RIGHT_ALT2 GACAATTTCACAAGCACAGGTTGAG 0.5 1 varskip-0317-1_07_LEFT_ALT2 CCTCTAAAAGCCCCAAAAGAAATTATC 0.5 1 varskip-0317-1_09_RIGHT_ALT2 GTTTACTTTCAGTTATAAATGGCTTAACTTC 0.5 1 varskip-0317-1_11_LEFT_ALT2 GTGGCACTACTGAAATGCTAGC 0.5 1 varskip-0317-1_13_RIGHT_ALT2 TTCATAAGAAAGTGTGCCCATGTAC 0.5 1 varskip-0317-1_15_RIGHT_ALT1 GCTCCAAAGACAACGTATACACC 0.5 1 varskip-0317-1_35_LEFT_ALT2 GATGATTATTTCAATAAAAAGGACTGGTATG 0.5 1 varskip-0317-1_45_RIGHT_ALT2 ATTGATCTCCAGGCGGTGGTTT 0.5 1 49_R_ALT2 GTAATAAGAACACCATTACGGGCAT 0.5 1 varskip-0317-1_53_RIGHT_ALT2 TGAGGATCTGAAAACTTTGTCAGG 0.5 1 55_L_ALT1 CCTACTTATTGTTAATAACGCTACTAATGTT 0.5 1 varskip-0317-1_57_LEFT_ALT6 CTCTGCTTTACTAATGTCTATGCAGA 0.5 2 varskip-0317-1_24_LEFT_ALT2 GCCTTTAATACTTTACTATTCCTTATGTC 0.5 2 varskip-0317-1_28_RIGHT_ALT2 AGGCCAAAGTAACAAGTACAAAAATAGC 0.5 2 varskip-0317-1_32_RIGHT_ALT2 CTGTTATTGCCTGACCAGTACC 0.5 2 varskip-0317-1_34_RIGHT_ALT2 ATCACAGAATTGTACTGTTTTTAACAAAGC 0.5 2 varskip-0317-1_54_RIGHT_ALT2 CTTCAAGGTCCATAAGAAAAGGCT 0.5 2 56L_ALT1 TTATTATGTGGGTTATCTTCAACCTAGG 0.5 2 varskip-0317-1_56_RIGHT_ALT2 CAGCCTGTAAAATCATCTGGTAATTTAT 0.5 Protocols for use of spike-in primers: For 96-reaction kits: Thaw VSSv2f Spike-in Mix 1, VSSv2f Spike-in Mix 2, VSSv2 Primer Mix 1. and VSSv2 Primer Mix 2. Mix and quick spin all four tubes. Add 3 μl of VSSv2f Spike-in Mix 1 to VSSv2 Primer Mix 1, vortex, spin-down, place on ice. Add 2.5 μl of VSSv2f Spike-in Mix 2 to VSSv2 Primer Mix 2, vortex, spin-down, place on ice. Use spiked VarSkip Short v2 Primer Mix 1 and 2 for RT-PCR protocol. For 24-reaction kits: Thaw VSSv2f Spike-in Mix 1, VSSv2f Spike-in Mix 2, VSSv2 Primer Mix 1. and VSSv2 Primer Mix 2. Mix and quick spin all four tubes. Add 2 μl of VSSv2f Spike-in Mix 1 to 2 μl 0.1x TE to make a ½ dilution of the VSSv2f Spike-in Mix 1. Add 1.5 μl of diluted VSSv2f Spike-in Mix 1 to VSSv2 Primer Mix 1, vortex, spin-down, place on ice. Add 2 μl of VSSv2f Spike-in Mix 2 to 2 μl 0.1x TE to make a ½ dilution of the VSSv2f Spike-in Mix 2. Add 1.25 μl of diluted VSSv2f Spike-in Mix 2 to VSSv2 Primer Mix 2, vortex, spin-down, place on ice. Use spiked VarSkip Short v2 Primer Mix 1 and 2 for RT-PCR protocol.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924