New England Biolabs, E7780S, NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2)

NEBNext Multiplex Oligos provide adaptors and primers to enable high yield multiplex Illumina library production. The unique hairpin loop structure of the NEBNext Adaptor minimizes adaptor-dimer formation, and NEBNext index PCR primers enable index incorporation during library amplification. This kit includes 8 i5 index primers and 12 i7 index primers for dual indexing. Related Categories NEBNext® Multiplex Oligos (Adaptors & Primers) FAQ Q: Where can I find the sample sheets for these Multiplex Oligos? A: Instrument-specific sample sheets can be downloaded from the Usage Guidelines section located under the “Protocols, Manual & Usage” tab. If you are sequencing on a NovaSeq® 6000 with v1.0 reagent kits, MiniSeq® with Rapid reagent kits, MiSeq®, HiSeq® 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell), please choose the sample sheet labeled “Forward Strand Workflow Sample Sheet”. * If you are sequencing on a iSeq 100, MiniSeq® with Standard reagent kits, NextSeq® Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell), please choose the sample sheet labeled “Forward Strand Workflow Sample Sheet”. * * Our samples sheets are based on the current Illumina Sequencing Overview Guide. Please choose the correct sample sheet, based on your Illumina instrument and reagent kits. For more information on Illumina indexing please refer to the most current version of the Illumina Sequencing Overview Guide. Q: Are NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2) supplied with library prep reagents? A: No. NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 2) includes nly adaptors, PCR primers, and USER® Enzyme. NEBNext library preparation kits are sold separately. Q: Can I use NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2) for library preparation from DNA and RNA samples? A: Yes. NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 2) are compatible with both DNA and RNA library preparation. Please refer to the appropriate chapters in the manual for DNA, ChIP or RNA library preparation protocols. Q: How many libraries can I prepare with the NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2)? A: Up to 96 libraries can be prepared with each NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 2) kit. Q: For pooling <96 samples, what combination of indices should I use? A: Please refer to Appendix A in Chapter 10 of the manual (page 115) for a detailed guideline for low level indexing. Q: Do I need to spike in custom sequencing primers when sequencing libraries are made with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2) on Illumina sequencing instruments? A: No. Libraries made using NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 2) are fully compatible with Illumina sequencing protocols for TruSeq® HT libraries. For HiSeq®, HiScan®SQ, or GAIIx® systems on single-read flow cells, the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (Illumina catalog # FC-121-1003) will need to be ordered separately when using both indices. This add-on box is not required with the MiSeq® System or on paired-end flow cells for HiSeq, HiScanSQ, GAIIx. Please refer to the Illumina website for complete information. Q: Can I perform single read runs and still get both index sequences? Can I run both single read and paired-end recipes with dual-indexed libraries? A: Yes. Please select the appropriate workflow based on the flow cell type (Single Read or Paired End) when starting your run so that the correct chemistry is used. If using a single-read flow cell the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (catalog #FC-121-1003) is necessary in order to sequence both index reads. Adapted from Illumina website. Q: Is the USER® Enzyme in the NEBNext Oligos kits identical in concentration to the standalone product? A: Yes, the concentration of USER in NEBNext Oligo kits is 1,000 U/ml, which is also sold separately as NEB #M5505. Q: How do I use the NEB provided Sample Sheet for my specific instrument? A: When using LRM, use the provided .tsv file on the product page "Usage Guidelines" section. If not using LRM: Download sample sheet from the product page for the index kit you are using from the NEB.com website. Sample sheets can be found on the Protocols, Manuals and Usage/ Usage Guidelines section or FAQs and Troubleshooting/ Do you have a sample sheet. For dual indexed libraries, ensure the correct version of the sample sheet is downloaded per https://knowledge.illumina.com/software/general/software-general-reference_material-list/000001800, Illumina Knowledge Base Article 1800. Use Illumina Experiment Manager to create a sample sheet for your specific instrument and sequencing run settings. Make a sample sheet with a single row and open it in excel. Copy and paste the index sequences from the NEB sample sheet into this excel file. Make sure columns line up with column headers. Please contact Illumina Technical Support for any additional questions about using IEM or sample sheet formatting. Q: Are dual indexed libraries compatible with single end sequencing? A: Yes, the NEBNext Oligos for Illumina, including dual index oligos, are compatible with single read sequencing. Please refer to Illumina’s Indexed Sequencing Overview Guide (current version) for details on dual indexed sequencing workflows on a single-read flow cell or a paired-end flow cell. Q: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument? A: The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq: Adaptor Read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Adaptor Read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT