Product Description
NEBNext Related Categories NEBNext® Multiplex Oligos (Adaptors & Primers),, Next Generation Sequencing Library Preparation FAQ Q: What is the difference between NEBNext Unique Dual Index UMI Adaptors and NEBNext Adaptors for use with multiplex primers? A: NEBNext Unique Dual Index UMI Adaptors are barcoded full-length adaptors that contain all sequences necessary for sequencing on the Illumina platforms. They are compatible with PCR-free library preparation. In addition, these adaptors carry a 12-base unique molecular identifier (UMI) 3´ to the i7 index, enabling more accurate removal of duplicate reads and error correction through consensus sequence building. On the other hand, the NEBNext Adaptor is truncated and does not contain sample index. Index and other sequences necessary for sequencing on the Illumina platform are introduced through primers during PCR amplification when using the NEBNext Adaptor. Therefore, libraries generated using the NEBNext Adaptor are not compatible with PCR-free library preparation. Q: What are the main applications for the NEBNext Unique Dual Index UMI Adaptors DNA Sets 1-4? A: The NEBNext Unique Dual Index UMI Adaptors DNA Sets 1-4 are recommended for applications that require PCR-free library preparation and sample pooling prior to PCR amplification. In addition, the incorporation of a 12 base unique molecular identifier (UMI) allows 1) accurate identification and removal of duplicate reads, and 2) consensus sequence building and error correction, ideally suited for accurate analysis of quantitative NGS data including low level frequency mutation detection. Furthermore, the Unique Dual Index UMI Adaptors were designed to facilitate sequencing on patterned flow cell for the Illumina instruments where index hopping is problematic. The unique combination of dual indices allows identification and complete filtering of index-swapped reads. https://www.biorxiv.org/content/early/2017/10/10/200790 Q: How long are the UMIs and where are they on the adaptors? A: The UMIs are 12 bases long and located 3′ to the i7 indices. Q: How are UMIs sequenced, and where can I find them? A: The UMIs are sequenced as part of the i7 index reads for a total of 20 bases. They can be found in the i7 index reads. Q: Can I skip UMI sequencing if I don’t need the UMIs for my applications? A: Yes. You can skip UMI sequencing and set i7 index read to 8 bases in this case. The design of the NEBNext Unique Dual Index UMI Adaptors allows flexible index sequencing modes, and they are compatible with single index reads (with and without UMI) and dual index reads (with and without UMI). Q: Are the NEBNext Unique Dual Index UMI Adaptors DNA Sets 1-4 compatible with NEBNext reagents for Illumina library preparation? A: Yes, the NEBNext Unique Dual Index UMI Adaptors DNA Sets 1-4 are compatible with NEBNext kits for Illumina DNA, RNA and ChIP-Seq library preparation. However, they are not compatible with Illumina small RNA library preparation. For small RNA library preparation for Illumina, please refer to our kits (NEB #E7300 and E7580), which contain their own adaptor and barcoded primers. Q: Are the NEBNext Unique Dual Index UMI Adaptors DNA Sets 1-4 compatible with commercially available library prep reagents? A: They are compatible only with standard library preparation protocols that are based on T/A single-base overhang ligation. Q: How many reactions worth of the UMI adaptors are in each well? A: The adaptor plate was designed to be single use. Although there is enough adaptor in each well for only one reaction, we provide excess adaptors to ensure sufficient volume. We strongly recommend that you do not use any leftover adaptors to avoid cross contamination with other indexed adaptors. Q: Are the adaptors methylated? A: No, the adaptors in NEB #E7395, #E7874, #E7876, and #E7878 are not methylated, and therefore are not compatible with bisulfite sequencing. For methylated adaptor and indexed primers, please refer to NEB #E7140. Q: What is the concentration of the adaptors and PCR primer mix in the NEBNext Multiplex Oligos (Unique Dual Index UMI Adaptors DNA Sets 1-4)? A: The adaptors are 20 µM and the primers are 40 µM. Q: How many indices are available with NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors DNA Sets1-4)? A: Each set comprises 96 unique i5 and 96 unique i7 indices, therefore, providing up to 96 unique dual indices. Each well of the adaptor plate contains a unique pair of one i5 index and one i7 index. Used together, Sets 1-4 provide 384 unique dual index primer pairs for multiplexing. Q: Are the NEBNext Unique Dual Index UMI Adaptors DNA Sets 1-4 validated in next generation sequencing workflows? A: Yes, the NEBNext UMI adaptors are validated by preparing genomic DNA libraries and human mRNA libraries, followed by Illumina sequencing. Q: Are the NEBNext UMI Adaptors compatible with single-end and paired-end sequencing? A: Yes, the NEBNext UMI Adaptors are compatible with both single- and paired-end sequencing. Q: Do I need to spike in custom sequencing primers when sequencing libraries made with NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors DNA Sets 1-4) on the Illumina platforms? A: No. Libraries made NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptor DNA Sets 1-4) are fully compatible with Illumina sequencing protocols of TruSeq HT libraries. For HiSeq, HiScanSQ, or GAIIx systems on single-read flow cells, the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (catalog # FC-121-1003) will need to be ordered separately when using both indices. This add-on box is not required with the MiSeq System or on paired-end flow cells for HiSeq, HiScanSQ, GAIIx. Please refer to Illumina website for complete information. Q: Can I perform single read runs and still get both index sequences? Can I run both single read and paired-end recipes with dual-indexed libraries? A: Yes. Please select the appropriate workflow based on the flow cell type (Single Read or Paired End) when starting your run so that the correct chemistry is used. If using a single-read flow cell the TruSeq Dual Index Sequencing Primer Box, Single Read (single use box) (catalog #FC-121-1003) is necessary in order to sequence both index reads. Adapted from Illumina website. Q: Where can I find the sample sheets for the NEBNext Unique Dual Index UMI Adaptors DNA Sets 1-4? A: Instrument-specific sample sheets can be downloaded from the Usage Guidelines section located under the “Protocols, Manual & Usage” tab on the relevant Set’s product page, or find it in the below table: NEBNext Unique Dual Index UMI Adaptors DNA: Sample Sheet Version: File Name (Includes Illumina platform details*): Set 1 (NEB #E7395) Forward Forward Strand Workflow Sample Sheet for E7395: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) Reverse Reverse Complement Workflow Sample Sheet for E7395: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) UMI Forward Forward Strand Workflow Sample Sheet for E7395 UMI: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) UMI Reverse Reverse Complement Workflow Sample Sheet for E7395 UMI: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) Set 2 (NEB #E7874) Forward Forward Strand Workflow Sample Sheet for E7874: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) Reverse Reverse Complement Workflow Sample Sheet for E7874: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) UMI Forward Forward Strand Workflow Sample Sheet for E7874 UMI: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) UMI Reverse Reverse Complement Workflow Sample Sheet for E7874 UMI: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) Set 3 (NEB #E7876) Forward Forward Strand Workflow Sample Sheet for E7876: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) Reverse Reverse Complement Workflow Sample Sheet for E7876: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) UMI Forward Forward Strand Workflow Sample Sheet for E7876 UMI: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) UMI Reverse Reverse Complement Workflow Sample Sheet for E7876 UMI: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) Set 4 (NEB #E7878) Forward Forward Strand Workflow Sample Sheet for E7878: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) Reverse Reverse Complement Workflow Sample Sheet for E7878: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) UMI Forward Forward Strand Workflow Sample Sheet for E7878 UMI: NovaSeq 6000 with v1.0 reagent kits, MiniSeq with Rapid reagent kits, MiSeq, HiSeq 2000/2500 (paired-end flow cell), HiSeq 3000/4000 (single-read flow cell) UMI Reverse Reverse Complement Workflow Sample Sheet for E7878 UMI: iSeq 100, MiniSeq with Standard reagent kits, NextSeq Systems, NovaSeq 6000 with v1.5 reagent kits, HiSeq 2000/2500 (single-read flow cell), HiSeq 3000/4000 (paired-end flow cell) * Our samples sheets are based on the current Illumina Sequencing Overview Guide. Please choose the correct sample sheet, based on your Illumina instrument and reagent kits. For more information on Illumina indexing please refer to the most current version of the Illumina Sequencing Overview Guide. Q: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument? A: The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq: Adaptor Read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Adaptor Read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Q: What do I do if I received an index collision/barcode collision error? A: If you received an index collision error when demultiplexing the NEBNext Multiplex Oligos, upgrade to: Software Version Bclconvert 4.1.7 or later Bcl2fastq Any version Picard IlluminaBasecallsToSam Any version Reach out to Technical Support if you have more questions.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924