Iright
BRAND / VENDOR: New England Biolabs

New England Biolabs, E8201S, NEBExpress® MBP Fusion and Purification System     

CATALOG NUMBER: E8201S
Regular price$0.99
/
Shipping calculated at checkout.
  • ddddd

    99 xxxxxx

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
The NEBExpress Related Categories Amylose Purification (MBP-tag),, NEBExpress MBP Fusion and Purification System,, Non-T7 Expression, Applications Target Protein Insolubility ,, Non-T7 Expression,, Expression of Difficult Proteins, FAQ Q: What strain(s) do you recommend as hosts for the pMAL vectors? A: We recommend NEBExpress Competent E. coli (NEB #C2523). This is an E. coli B strain similar to T7 Express and BL21 (DE3), except that it lacks the T7 RNA Polymerase (the pMAL vectors use the E. coli RNA Polymerase). NEB Express, T7 Express (NEB #C2566), BL21 (NEB #C2530) and BL21(DE3) (NEB #C2527) Competent E. coli all give similar results – the presence of the T7 RNA Polymerase doesn't seem to have any effect. Other successful strains include NEB 10-beta (NEB #C3019) and NEB Turbo (NEB #C2984) Competent E. coli. One can start with NEB Express, or with whatever competent cells are readily available, and then try another strain if a problem with expression or purification develops. Q: What primers should I use to sequence the ends of my insert after I clone it into a pMAL vector? A: The following sequencing primers can be used (not available from New England Biolabs): malE primer on the 5′ side of the insert and the pMAL reverse primer for sequencing from the 3′ side. Forward Primer (24-mer, upstream of MCS) 5′d(GGTCGTCAGACTGTCGATGAAGCC)3′ Reverse Primer (24-mer, downstream of MCS) 5′d(TGTCCTACTCAGGAGAGCGTTCAC)3′ The sequences of the pMAL vectors are also available at www.neb.com. PCR of inserts cloned into the MCS can be performed using the same primer pair. Q: What is the minimum size of a fragment that can be cloned into pMAL and expressed fused to MBP? Can short peptide sequences (~ 10 amino acids) be added onto MBP? A: The MBP system can be used to express short peptides. However, 40 mg of MBP yields ~1 mg of a 10 amino acid peptide (1.1 kDa). Q: How many times can I use the amylose column? A: The most important variable in determining the useful life of the amylose resin is the amount of time it is in contact with trace amounts of amylase present in the crude extract. Under normal conditions (crude extract from 1 liter of cells grown in LB + 0.2% glucose, 15 ml column), the column loses 1–3% of its initial binding capacity each time it is used. If the yield of fusion protein under these conditions is 40 mg, this means that after 3 to 5 runs there would be a decrease in the yield. In practice, we often use a column 8 or 10 times before we notice a significant drop in the yield. Q: Can I substitute a different buffer and/or salt concentration in the Column Buffer? A: Yes, HEPES, MOPS, and phosphate buffers (at pH values ranging from 6.5 to 8.5) can be used instead of Tris-HCl in the Column Buffer with similar results. NaCl or KCl concentrations of 25 mM to 1 M are also compatible with the affinity purification. Q: Can I perform a batch purification using the amylose resin? A: Yes, batch purification works well, although it is difficult to wash all the nonspecific proteins away as effectively as in a column due to the included volume in the resin. The resin can withstand centrifugation at up to 6000 x g. A good compromise is to load the resin in a batch mode, by incubating with shaking for 2 hours to overnight, then pour it in a column to wash and elute. Dilution of the crude extract may not be critical for loading the column by the batch method. Q: Can MBP fusions be purified in the presence of denaturants like urea or guanidine-HCl? A: No, MBP’s affinity for amylose and maltose depends on hydrogen bonds that in turn are positioned by the three-dimensional structure of the protein. Agents that interfere with hydrogen bonds or the structure of the protein interfere with binding as well. Q: How can TEV Protease be removed from the reaction after cleavage? A: TEV Protease contains a polyhistidine tag at its N-terminus and can be removed from the reaction by immobilized metal affinity chromatography, such as NEBExpress Ni-NTA Magnetic Beads (NEB #S1423), NEBExpress Ni Spin Columns (NEB #S1427), or NEBExpress Ni Resin (NEB #S1428). The Ni-NTA Magnetic Beads will require dialysis to remove the DTT present in the TEV Protease Reaction Buffer, whereas TEV Protease digests can be directly loaded onto NEBExpress Ni Spin Columns or NEBExpress Ni Resin, since these two resin formats are chemically resistant to DTT. Q: Is the rate of TEV Protease cleavage affected by urea or guanidine hydrochloride? A: The activity of TEV Protease on an MBP-fusion protein in the presence of these denaturants has been reported by C. Sun et al. as follows: Urea: In up to 2 M urea near complete cleavage is detected. There is some inhibition of TEV Protease cleavage in urea concentrations of 4 M. Guanidine HCl: 1 M guanidine HCl yields slight inhibition of TEV Protease cleavage; however, some TEV Protease activity is still observed in the presence of 3 M guanidine HCL. Sun, C. et al. (2012) Protein Expression and Purification 82, 226–231. Q: How do I separate MBP and TEV Protease from the protein of interest? A: Both MBP and TEV Protease contain polyhistidine tags that can be used to remove them from the protein of interest. The TEV Protease digestion can be directly loaded onto NEBExpress Ni Spin Columns (NEB #S1427) or NEBExpress Ni Resin (NEB #S1428), since these resin formats are chemically resistant to the DTT in the TEV Protease reaction buffer. If using NEBExpress Ni-NTA Magnetic Beads (NEB #S1423) or another immobilized metal affinity chromatography format, we recommend dialyzing the TEV Protease digestion into a compatible buffer prior to IMAC. Q: I want to rebind MBP to the amylose column, but the maltose must be removed. Can this be done by dialysis? A: Dialysis does not work very well to remove maltose from maltose-binding protein. This is a general phenomenon of binding protein/ligand interactions; after the free ligand is gone, ligand that is released from the binding site usually finds another binding site before it encounters the dialysis membrane. We have determined empirically that binding the fusion to a chromatography resin and then washing away the maltose is much more effective. Standard chromatography (e.g., DEAE) is a preferred separation step, since it can separate the TEV Protease and MBP from the protein of interest if immobilized metal affinity chromatography is not an option. In case MBP co-elutes with the protein of interest, we include a large volume washing step to remove the maltose before starting the salt gradient. This way, the mixture can be run over an amylose column afterward if necessary. Alternatively, we recommend utilizing the polyhistidine tags present on both MBP and TEV protease with immobilized metal affinity chromatography to separate them from the protein of interest following digestion with TEV Protease. Q: How should I store my protein after it is purified? A: Most proteins can be stored for at least a few days at 4°C without denaturing. For long term storage, one can either freeze at -70°C or dialyze into 50% glycerol and store at -20°C. When storing at -70°C, aliquot the protein so only the portion to be used must be thawed – repeated freeze/thaw cycles denature many proteins. Q: What is MBP6? Is it different from wild-type MBP produced from E. coli? A: MBP6 is the protein produced from pMAL-c6T that utilizes the naturally occurring stop codon following the SbfI recognition sequence. It differs from wild-type MBP by the addition of a methionine at the N-terminus (as do all fusions made in pMAL-c vectors), the mutations that increase the affinity of MBP for the amylose resin, the deletion of the last four residues of wild-type MBP, and the addition of the residues encoded by the spacer and the TEV protease site. MBP6 is a monomer with a molecular weight of 45.5 kDa and a calculated pI of 4.9. Q: What gravity column do you recommend? A: We recommend the 2.5 cm (internal diameter) Econo Column line from Bio-Rad or the Kontes Flex-Column. Column sizes (internal diameter and length) can be scaled up or down and should be based on the amount of resin needed to isolate your protein of interest in sufficient yields. Q: Is the amylose resin damaged by storage at -20°C? A: We do recommend the beads be stored at 4°C and not ever frozen The resin will freeze at -20°C but the performance of the resin is not degraded by one freeze/thaw cycle. Freezing the product in a solution other than our storage solution (i.e. in the absence of 20% ethanol) can result in reduced performance/degradation of the resin, so functional performance should be verified by the customer prior to use. Q: What is known about binding in the presence of nonionic detergents? A: Some fusion proteins do not bind efficiently (< 5% binding) in the presence of 0.2% Triton X–100 or 0.25% Tween 20, while other fusions are unaffected. For one fusion that does not bind in 0.25% Tween 20, diluting the Tween to 0.05% restores about 80% of the binding.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924