New England Biolabs, M0298S, Cre Recombinase

Related Categories Recombinases Specification Unit Definition One unit is defined as the amount of enzyme necessary to produce maximal site-specific recombination of 0.25 μg pLox2+ control DNA in 30 minutes at 37°C in a total reaction volume of 50 μl. Maximal recombination is determined by agarose gel analysis and by transformation of reactions followed by selection on ampicillin plates. Reaction Conditions 1X Cre Recombinase Reaction Buffer Incubate at 37°C 1X Cre Recombinase Reaction Buffer 33 mM NaCl 50 mM Tris-HCl 10 mM MgCl2 (pH 7.5 @ 25°C) Usage Concentration 1,000 - 15,000 units/ml Storage Buffer 15 mM Tris-HCl 250 mM NaCl 0.3 mg/ml BSA 50% Glycerol pH 8 @ 25°C Heat Inactivation 70°C for 10 minutes FAQ Q: What is the molecular weight of Cre Recombinase? A: 38 kD Q: Can Cre Recombinase be used to linearize a BAC containing a loxP site? A: We have not tested this here but the following paper may be helpful: Buchholz F, Bishop M. (2001). Biotechniques 31(4):906-918 ""LoxP-Directed cloning: use of Cre recombinase as a universal restriction enzyme."" Q: What is the sequence of the loxP sites in the pLox2+ control DNA to be used with Cre Recombinase? A: 5' ATAACTTCGTATAATGTATGCTATACGAAGTTAT 3' (1) (1) Metzger, D. and Feil, R. (1999) Curr. Opin. Biotechnol. 10, 470-476. Q: Why aren't the product bands from my Cre Recombinase reaction mix sharp when run on an agarose gel? A: Incubation of the Cre Recombinase reaction mix at 70°C for 10 minutes is recommended before agarose gel analysis. This helps reduce gel artifacts. Q: Can Cre Recombinase be used to move an insert between expression vectors? A: Yes, if the insert is in a donor vector and the expression vector has been engineered to accept it. At present (10/02) NEB does not sell a kit to make donor plasmids and none of our plasmids have been engineered to accept inserts. Check with the product manager for updates on plasmid engineering.