Product Description
Recover damaged, compromised, or degraded DNA samples Related Categories DNA Manipulation,, DNA Repair Enzymes and Structure-specific Endonucleases Applications PCR,, PCR FAQ Q: Will PreCR ligate my DNA fragments? A: The ligase present in the PreCR Repair Mix is Taq DNA ligase (NEB #M0208). This ligase effectively seals nicks in DNA, but is not effective at ligating fragments at a mismatch or at ligating blunt ended DNA. In fact, we have never observed this enzyme to ligate blunt ended DNA. Q: How much DNA will PreCR repair? A: Although we recommend up to 500 ng in the data card this is only a generalization. The amount of DNA that can be repaired depends on many factors, such as the type of damage or damages and the total amount of damage. We have repaired 1 µg of DNA using 1 µL of the PreCR Repair Mix enzyme cocktail and we do not consider this to be the actual upper limit. The flip side to this question is how little DNA is safe to use with the PreCR Repair Mix. We have not found a lower limit of DNA concentration for repair. Typically, the concentration of DNA in the PreCR Repair Mix reaction is not a significant concern for performing the reaction. Q: Will treating my DNA with the PreCR Repair Mix hurt my reaction? A: No. We have not seen the PreCR Repair Mix have a negative effect on a PCR reaction. Because of the complexity of DNA damage there may be cases that we have not encountered in which PreCR treatment has a negative effect. A possible scenario for this would be a situation in which the degraded DNA is mostly single stranded. Some of the repair enzymes can act upon ssDNA, but the ssDNA lacks the complimentary strand required for full repair. Q: What is the sequence of the L1 primer mix? A: There is both a forward and reverse primer in the mix. The primer sequences are: CCTGCTCTGCCGCTTCACGC and GATGACGCATCCTCACGATAATATCCGG for the forward and reverse primers, respectively. These primers are described in Wang, Y., et al., Nucleic Acids Res. (2004) 32(3):1197. Q: How is the damaged DNA that you test the PreCR Repair Mix against created? Can I buy this damaged DNA separately? A: We have tested the PreCR Repair Mix on DNA that has abasic sites, oxidized bases, UV damage, and dU in addition to heat damaged DNA. The abasic sites are generated by incubation at pH 5 as described in Ide, H., et al (Biochemistry (1993) 32(32):8276-83). DNA oxidation is accelerated by methylene blue (Boiteux, S., et al, (1992) 31(1):106-10). UV damage by exposure to a UV light. Plasmid DNA with dU is obtained from an dut-/ung- strain of E. coli K12 CJ236 (NEB#E4141). UV damaged DNA is available from NEB only as part of the PreCR Repair Mix kit. Q: Why does my control reaction not give a detectable amplicon? A: Try increasing the number of cycles from 25 to 30. Q: Can I buy any of the PreCR Repair Mix components separately? A: The 2 components not sold separately are: L1 primer mix and the UV damaged lambda DNA. Q: Will the PreCR Repair Mix blunt the ends of the DNA? A: No. The polymerase present in PreCR, Bst polI, will fill-in 5’ overhangs, but will not remove 3’ overhangs. Furthermore, this polymerase will add a dA to the filled-in 5’ overhang. If blunt ended DNA fragments are desired after PreCR treatment use the following protocol. Blunting Protocol. This protocol uses the optimal repair buffer (ThermoPol Buffer), but it is it is best to clean-up the DNA before performing the blunting reaction for two reasons. 1) the Bst polymerase, if active, will add a dA to the blunted DNA and thus compete with the polymerase chosen to perform the blunting reaction. 2) if the blunted DNA needs to be phosphorylated using T4 PNK then the (NH4)2SO4 present in the ThermoPol buffer must be removed because it is known to inhibit T4 PNK. The protocol starts with performing the DNA repair reaction as described in the PreCR Repair Mix datacard. After repair the DNA should be purified, ie spin column, ethanol precipitation. The purified DNA is subjected to blunting. For DNA blunting we recommend the Quick Blunting Kit (NEB#E1201). For blunting and ligation NEB has conveniently bundled the Quick Blunting and Quick Ligation kits (NEB#E0542). Q: Why don’t I see the expected band from my repaired template? A: There are a number of possible issues. First, if possible, it is a good idea to make sure the PCR reaction is properly optimized using a fresh DNA template. For example, if you are amplifying DNA from degraded moth samples, check the PCR reaction using a fresh DNA sample from the same species. Second, there may be PCR inhibitors present in the extracted DNA. This can be tested using a PCR reaction that is known to work and then adding in an aliquot of the extracted DNA. If the PCR reaction is inhibited by the presence of the extracted DNA in question PCR inhibitors may be an issue. In this case be sure to use albumin in the repair and amplification reactions because albumin is known to mitigate the effects of some types of PCR inhibitors. Another simple, but effective method is to run a series of PCR reactions in which the extracted DNA template is present at a range of dilutions. The idea is to find the point at which the inhibitor is dilute enough to allow PCR and there is still enough DNA template to allow amplification. Other problems are that the DNA is simply too degraded to be recovered or that the damage present is not repaired by the PreCR Repair Mix, i.e. DNA-protein crosslinks. Q: Is my buffer compatible and which reaction should I use? A: If your buffer is one of the following: Thermopol, stadard Taq, Phusion HF, Pusion GC, or DyNazyme Ext buffer then you can use the standard protocol. If your buffer is one of the following: AccuTaqLA. Pfu, iTaq, or Accu-prime Pfx then use the sequential reaction protocol. Q: Does the PreCr Repair Mix insert random nucleotides into the sequence that it repairs? A: No, the polymerase in the mix adds the complementary bases that correspond to the template stand. The repair mix will not introduce changes into the sequence. Q: Does the PreCR Repair Mix contain any contaminating human DNA? What are the quality controls that are used to test that? A: The PreCR Repair Mix is not certified as being free of human DNA. The quality controls assays are all done on E. coli DNA, not human substrates. Q: Does the PreCR Repair Mix remove covalent modifications from DNA bases, such as biotin or digoxigenin? Does it repair mismatches/ extra bases in DNA? A: This repair mix will not remove covalent modification in the DNA bases. It will repair basic DNA damages such as abasic sites, nicks, thymine dimers, deaminated cytosine, oxidized guanine and pyrimidine. It also polishes 3' to hydroxyl if there is a block at 3' end. If the mismatches fall in those categories, yes, PreCR will repair it. Otherwise, no. Q: If there are gaps and nicks remaining from a ligation reaction, will the PreCR Repair Mix repair all of these, so that the DNA will be suitable for microinjection into mice, for example? A: Full length Bst DNA polymerase is the DNA polymerase present in the PreCR Repair Mix. This polymerase fills-in gaps and removes damaged bases when directed by the repair enzymes in the mix. Bst DNA polymerase is able to do this because it has 5'-3' exonuclease activity, in addition to the DNA polymerase activity. It does not, however, have 3'-5' exonuclease activity, also known as proof-reading activity. Q: Can the PreCR Repair Mix be used for paraffin-embedded DNA? A: The PreCR repair mix will not work with fixed samples. If the DNA can be extracted from the fixed samples, the PreCR Repair Mix can then be used to repair the purified DNA. Q: The repaired DNA will be used for an Nsp1 or Sty1 digestion followed by an adapter ligation, and PCR. Do you recommend cleanup of the PreCR Repair Mix reaction prior to this process? A: If the polymerase in the PreCR Repair Mix is still present and active when the DNA ends are generated by restriction enzyme digest, it may modify those ends (either by filling in the overhang or adding a non-templated dA in a manner similar to Taq DNA Polymerase) and interfere with the subsequent steps. A heat kill step (80oC for 20 minutes) or a DNA clean-up step is therefore recommended. The DNA can then be either ethanol precipitated or purified by the use of a spin-column. Q: Can the PreCR Repair Mix repair damage in both single and double stranded DNA? Or, does it require a double stranded DNA as a template? A: The PreCR repair mix is for use with double stranded DNA. Some of the DNA repair enzymes contained in the mix can recognize damage in ssDNA, but the polymerization and ligation steps require dsDNA. Q: Is the addition of dNTPs necessary for the PreCR Repair Mix to work properly? A: Yes. Repair will be affected if dNTP's are not added. Q: If I had a DNA template with mutation sites (ie. 8-oxoguanine or deaminated cytosines) that are directly adjacent to each other on opposite strands would treatment with PreCR™ Repair Mix cause a double strand nick/break? A: We have not tried testing the repair of a double strand break. In this scenario, if the two damaged bases are removed at the same time, then a double stranded break could occur resulting in fragmented DNA. Highly fragmented DNA is difficult to repair. If, on the other hand, one reaction is faster than the other, and they do not occur simultaneously, then the PreCr Repair Mix most likely will repair them. Q: What gap lengths can be repaired with the PreCR Repair Mix? A: The exact gap length is not known. Based on our experience, it is between 5-10 nucleotides. Q: Does the PreCR Repair Mix work with less concentrated amounts of DNA (e.g. 500pg-1ng) than the amounts recommended? A: The repair mix has been tested with DNA template amounts as low as 100 pg. In this case the PreCR based repair occurs as well as at the higher DNA concentrations mentioned on the datacard. The 50-500 ng starting template concentration recommended for repair is simply a suggested reaction condition, and does not represent the limits of DNA concentration at which repair can be carried out by the PreCR Repair Mix. Q: When doing bisulfite treatments of templates, the subsequent PCR reactions can pose a problem as the DNA seems to be very labile after the treatment. Can the PreCR Repair Mix improve these PCR results? A: Our current mix has UDG in it and won't repair bisulfite-treated DNA templates. Leaving UDG out is a good idea, but for bisulfite sequencing, the DNA has to go through single-strand DNA step, and our current PreCR Repair Mix does not repair ssDNA sufficiently. Q: Is it necessary to clean the PreCR reaction prior to carrying out quantitative PCR? A: No. The dNTPs in the PreCR Repair Mix are not present in a high enough concentration to interfere with Q-PCR. Q: When working with fragments, will the ends be ligated together by the PreCR Reaction Mix? A: No, the Taq DNA ligase in the mix will only ligate where there is a nick in dsDNA. Q: Can T4 DNA ligase be used to ligate across an abasic site? A: T4 DNA Ligase will not ligate across and AP site. The PreCR Repair Mix will fix the AP site (in dsDNA only), add the proper base, and then ligate the dsDNA structure together. Q: How are abasic sites repaired by the PreCR Reaction Mix? Are new nucleotides put in and ligated? Is the existing nucleotide repaired? A: The DNA repair enzymes recognize the abasic site and cut the DNA backbone. The polymerase replaces the missing base with the correct base and the ligase ligates the DNA.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924