Iright
BRAND / VENDOR: Proteintech

Proteintech, G14418-1-5C, MultiPro® 5CFLX Anti-Human ATP1A1 (Polyclonal)

CATALOG NUMBER: G14418-1-5C
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The ATP1A1 (G14418-1-5C) by Proteintech is a Polyclonal antibody targeting ATP1A1 in Single Cell (Intra) applications with reactivity to Human samples G14418-1-5C targets ATP1A1 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information ATP1A1 is the catalytic component of Na+/K+-ATPase which is a membrane bound enzyme primarily involved in generation of Na+ and K+ gradients across plasma membranes and in determination of cytoplasmic Na+ levels. ATP1A1 is a ubiquitously expressed membrane protein and often used as the marker or internal control for plasma membrane protein. For optimal WB detection of this membrane protein, we recommend to avoid boiling the sample after lysis. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: CatNo: Ag5763 Product name: Recombinant human ATP1A1 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 347-681 aa of BC050359 Sequence: TAKRMARKNCLVKNLEAVETLGSTSTICSDKTGTLTQNRMTVAHMWFDNQIHEADTTENQSGVSFDKTSATWLALSRIAGLCNRAVFQANQENLPILKRAVAGDASESALLKCIELCCGSVKEMRERYAKIVEIPFNSTNKYQLSIHKNPNTSEPQHLLVMKGAPERILDRCSSILLHGKEQPLDEELKDAFQNAYLELGGLGERVLGFCHLFLPDEQFPEGFQFDTDDVNFPIDNLCFVGLISMIDPPRAAVPDAVGKCRSAGIKVIMVTGDHPITAKAIAKGVGIISEGNETVEDIAARLNIPVSQVNPRDAKACVVHGSDLKDMTSEQLDDI Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human ATP1A1 (Polyclonal) Calculated Molecular Weight: 113 kDa GenBank Accession Number: BC050359 Gene Symbol: ATP1A1 Gene ID (NCBI): 476 ENSEMBL Gene ID: ENSG00000163399 RRID: AB_3673887 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGAACATAATGATCCTCCCATATAAGAAA Barcode Sequence: GAACATAATGATCCT Form: Liquid UNIPROT ID: P05023 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924