Proteintech, G17038-1-5C, MultiPro® 5CFLX Anti-Human CXCL8/IL-8 (Polyclonal)

Size: 10ug The CXCL8/IL-8 (G17038-1-5C) by Proteintech is a Polyclonal antibody targeting CXCL8/IL-8 in Single Cell (Intra) applications with reactivity to Human samples G17038-1-5C targets CXCL8/IL-8 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Interleukin 8 (IL-8), also known as CXCL8, which is a member of the CXC chemokine family. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli. IL-8 has two primary functions. It induces chemotaxis in target cells, primarily neutrophils but also other granulocytes, causing them to migrate toward the site of infection. IL-8 also induces phagocytosis once they have arrived. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. IL-8 is also known to be a potent promoter of angiogenesis. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: CatNo: Ag10552 Product name: Recombinant human CXCL8/IL-8 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 1-99 aa of BC013615 Sequence: MTSKLAVALLAAFLISAALCEGAVLPRSAKELRCQCIKTYSKPFHPKFIKELRVIESGPHCANTEIIVKLSDGRELCLDPKENWVQRVVEKFLKRAENS Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CXCL8/IL-8 (Polyclonal) Calculated Molecular Weight: 99 aa, 11 kDa GenBank Accession Number: BC013615 Gene Symbol: IL-8 Gene ID (NCBI): 3576 ENSEMBL Gene ID: ENSG00000169429 RRID: AB_3673891 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGAGCTGAATAATGGCCCATATAAGAAA Barcode Sequence: CGAGCTGAATAATGG Form: Liquid UNIPROT ID: P10145 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.